Method for identifying and analyzing specific genomic locus interaction DNAs on basis of CRISPR/cas9 and peroxidase APEX2 system

A peroxidase and specific technology, applied in the direction of recombinant DNA technology, biochemical equipment and methods, and other methods of inserting foreign genetic materials, can solve the problem of not being able to specifically provide natural chromatin or genome-wide functional analysis , Changing the natural environment of chromatin, technical difficulties and other issues, to achieve high specificity, high sensitivity and good reproducibility

Inactive Publication Date: 2019-03-22
FUDAN UNIV
View PDF6 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These discoveries ushered the technical field into a new era of chromatin function research. However, a comprehensive understanding of chromatin function requires the identification of DNA, RNA, and transcription factors present at specific genomic loci. difficult and challenging
[0003] In recent years, studies have proposed techniques for local chromatin composition. For example, chromatin immunoprecipitation (ChIP) is one of the classic techniques widely used to study the genome-wide distribution of a given protein. However, there is no A widely accepted method for studying locally interacting molecules at a given genomic site; locked nucleic acid probes are used to identify proteins that bind to telomeric regions, but this method is limited to highly repetitive genomic regions; LexA DNA Binding sites are genetically integrated into the yeast genome for site-specific chromatin purification; however, this method requires genomic engineering of the target genome, which alters the natural environment of chromatin and is inefficient ; modified genome editing technologies such as transcription activator-like effector nuclease (TALEN) and clustered regularly interspaced short palindromic repeats (CRISPR / cas9) have been used to enrich desired genomic loci, however, TALEN-based methods require the design of an amino acid sequence for each site, CRISPR-based methods require cells to be cross-linked with formaldehyde, and antibodies with high affinity and specificity are required to be available, etc.; research practices have shown that the above Methods do not yet specifically provide functional analysis of native chromatin or genome-wide

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for identifying and analyzing specific genomic locus interaction DNAs on basis of CRISPR/cas9 and peroxidase APEX2 system
  • Method for identifying and analyzing specific genomic locus interaction DNAs on basis of CRISPR/cas9 and peroxidase APEX2 system
  • Method for identifying and analyzing specific genomic locus interaction DNAs on basis of CRISPR/cas9 and peroxidase APEX2 system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Embodiment 1, construction and transfection of plasmid expression vector

[0035] 1.1 Construction of plasmid expression vector: In order to construct MS2-APEX2_NLS fusion protein expression vector, APEX2 was amplified from pcDNA3 Connexin43-GFP-APEX2 (Addgene plasmid: 49385) plasmid by PCR method, and then it was amplified with BamHI and XhoI. Cut and cloned into the pHAGE-EFS-MCP-3XBFPnls (Addgene plasmid: 75384) vector, by connecting the annealed oligonucleotide fragment (oligos) and the BbsI restriction site to pLH-sgRNA1-2XMS2 ( Addgene plasmid: 75389) completed the construction of the sgRNA expression vector on the plasmid, and expressed dCas9 with Addgene plasmid 64107; all sgRNA sequences and are shown in Table 1;

[0036] Table 1 All sgRNA sequences

[0037] name

Sequence(5'-3')

sgRNA-Telomere

TAGGGTTAGGGTTAGGGTTA

sgRNA-Gal4

AACGACTAGTTAGGCGTGTA

sgRNA-C20-1

CTCTTAGCTGTTATGCTGTA

sgRNA-C20-2

GGATTCCCTTCCAT...

Embodiment 2

[0040] Embodiment 2, extract DNA and carry out ChIP experiment

[0041] 2.1 After 24 hours of cell transfection, when 2x107 cells were transfected with the target sgRNA or Gal4 control, the cells were treated with 500uM biotin-phenol (Iris Biotech GmbH, Germany) for 30 minutes, and then hydrogen peroxide (H 2 o 2 ) to a final concentration of 1 mM, and the cells were treated for 1 min, after which the reaction termination solution (10 mM sodium azide, 10 mM V c , 5mM Trolox) to terminate the reaction, and finally, fixed with 1% formaldehyde and incubated at room temperature for 10min. Lyse the cells with 1mL of hypotonic buffer (20mM HEPES pH7.5, 10mM potassium chloride, 1mM EDTA, 0.1mM activated sodium orthosclerate, 0.2% NP-40, 10% glycerol) for 15min, and store the cell lysate at 4°C , centrifuge at 13000g for 1min, discard the supernatant;

[0042] 2.2 Resuspend with 500ul ChIP dilution buffer (20mM Tris-HCl pH 8.0, 2mM EDTA, 150mMNaCl, 0.1% SDS, 1% TritonX-100);

[00...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biology, and relates to a method for identifying and analyzing specific genomic locus interaction DNAs on the basis of a CRISPR / cas9 and peroxidase APEX2 system. The method comprises the following steps: plasmid transformation, biotin labeling of specific locus binding protein complex, enrichment of biotin-labeled protein and DNA complex by utilizingstreptomycin magnetic beads and sequencing and analysis of enriched DNAs. An experimental analysis result shows that the method is applicable to the analysis of any genomic locus, and can obtain theinformation of genomic loci interacting with the genomic locus, and meanwhile, the idea that the method combines the CRISPR gene editing system with APEX2 to carry out specific locus DNA analysis is also applicable to the combination of other genome editing methods (such as TALEN) and the APEX2. The method has the advantages of simplicity in operation, high sensitivity, high specificity, good repeatability and adaption to the requirement of the research of local chromatin interaction DNAs at any given chromosomal location.

Description

technical field [0001] The invention belongs to the field of biological technology, and in particular relates to a method for identifying and analyzing DNA interacting with specific genomic sites based on CRISPR / cas9 and peroxidase APEX2 systems. Background technique [0002] The prior art discloses that in eukaryotic cells, DNA molecules are highly organized and tightly wrapped around repeating units of nucleosomes to form chromatin. However, in living cells, the structure of chromatin is dynamically changing, and localized chromatin can be accessed by regulatory elements such as transcription factors and non-coding RNAs. In recent years, several mechanisms for the regulation of chromatin organization have been proposed in the field. For example, each chromosome in the nucleus of eukaryotic cells is located in a specific region called a chromosome region, which contains many The domain called topological domain; in the topological domain, distal DNA elements regulate gene ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/90C12N9/22C40B50/06
CPCC12N9/22C12N15/907C12Q1/6851C12Q1/6869C40B50/06C12Q2531/113C12Q2521/107C12Q2563/107
Inventor刘贇邱文青
OwnerFUDAN UNIV