Unlock instant, AI-driven research and patent intelligence for your innovation.

Recombined litopenaeus setiferus protein SF-P9, preparation method and application thereof

A SF-P9, shrimp protein technology, applied in the fields of botanical equipment and methods, biochemical equipment and methods, applications, etc., can solve problems such as small molecular weight, and achieve the effect of inhibiting the growth of tumor cells

Active Publication Date: 2011-09-21
HUBEI TAIYANGHONG BIOLOGICAL TECH CO LTD
View PDF1 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Penaeidins have the basic commonality of antimicrobial peptides in primary and secondary structures, but the common features in structure and biological function are: (1) small molecular weight

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombined litopenaeus setiferus protein SF-P9, preparation method and application thereof
  • Recombined litopenaeus setiferus protein SF-P9, preparation method and application thereof
  • Recombined litopenaeus setiferus protein SF-P9, preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0116] Example 1 Amplification and cloning of Penaeidin gene in Penaeus vannamei

[0117] 1. Design and synthesis of amplification primers:

[0118] According to the pen-2 gene of shrimp peptide, a pair of primers P1 and P2 were designed. The primers were synthesized by Shanghai Shenggong Biological Engineering Co., Ltd. and purified by PAGE. The nucleotide sequences of P1 and P2 are respectively: upstream primer P1: 5'GAATTCTACAGGGGCGGTTACACA 3'. Downstream primer P2: 5'TCTAGAGCCTTGTCATCGTCATCTCCTTTTACTAAGTGACAACA 3'.

[0119] 2. Extraction of total RNA from Penaeus vannamei and synthesis of the first strand of cDNA:

[0120] The vannamei prawns were raised in a water tank with oxygen at 22°C for later use. Select healthy shrimps in the inter-molt period, rinse them with DEPC-treated sterile water, collect 750μL of hemolymph from the abdominal sinuses of the shrimps with a 2.5mL disposable syringe, add an equal volume of anticoagulant (pH7.0), and inspect under a microscope Count,...

Embodiment 2

[0151] Example 2 Construction and identification of recombinant shuttle plasmid pPIC6αA / Pen

[0152] 1. Construction of recombinant shuttle plasmid pPIC6αA / Pen:

[0153] Extract the recombinant plasmid pGEM-T / Pen, use Eco RI and Xba I double enzyme digestion to obtain the target fragment Pen; the same digestion pPIC6αA empty vector. After double digestion, the Pen and the empty vector pPIC6αA DNA fragment were exposed to T4DNA ligase at 16°C overnight to obtain the recombinant plasmid pPIC6αA / Pen.

[0154] The connection reaction system is as follows:

[0155] pPIC6αA vector DNA fragment: 2μl; penaeidin DNA fragment: 10μl; T4 DNA buffer: 1.5μl; T4 DNA ligase: 1.5μl.

[0156] Transform Escherichia coli with the recombinant plasmid pPIC6αA / Pen E.coli JM109 competent cells were screened for positive clones on LB plates containing 300μg / ml blasticidin to obtain E. coli strains E.coli JM109 (pPIC6αA / Pen). Use the lysis method to extract plasmid pPIC6αA / Pen DNA (see Molecular Cloning ...

Embodiment 3

[0167] Example 3 Transformation of recombinant shuttle plasmid pPIC6αA / Pen Pichia pastoris X-33

[0168] 1. Linearization of recombinant shuttle plasmid pPIC6αA / Pen DNA:

[0169] Prepare a small amount of recombinant plasmid pPIC6αA / Pen DNA 15-20μg, digest it with RNaseA at 37°C for 30 min, then use restriction enzymes in a 60μL system Sac I Carry out restriction enzyme digestion linearization. After keeping it in a 37°C water bath for 4 hours, extract once with phenol:chloroform (25:24) and once with chloroform:isoamyl alcohol (24:1), add 0.1 volume of 3M acetic acid Sodium (pH5.2), 2.5 times the volume of absolute ethanol, mix well and place it at -20°C for precipitation overnight, centrifuge at 4°C, 12000rpm for 20 minutes, discard the supernatant, and wash twice with 75% ethanol prepared in ultrapure water. After air-drying naturally, dissolve the precipitate with 5-10μL TE solution and store at -20°C for later use. Restriction endonuclease Sac I digested the linearized ve...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a recombined litopenaeus setiferus protein SF-P9, a preparation method thereof and an application thereof. Besides the invention also relates to coding of an amino acid sequence of the recombined litopenaeus setiferus protein SF-P9 and a DNA sequence corresponding to the amino acid sequence, a yeast recombination gene engineering bacterial strain Pichia pastoris X-33 / pPIC6alpha / Pen with a preservation code of CCTCC No: M209126, as well as the utilization of the engineering bacterial strain to express the recombined litopenaeus setiferus protein SF-P9. Moreover, the invention also discloses a litopenaeus setiferus protein F-P6, a preparation method and an application thereof. Besides, the coding of an amino acid sequence of the litopenaeus setiferus protein Pen6 and a DNA sequence corresponding to the amino acid sequence is also disclosed in the invention. The recombined litopenaeus setiferus protein SF-P9 has enterokinase sites. After the process of enterokinase cutting on the litopenaeus setiferus protein SF-P9, the litopenaeus setiferus protein F-P6 is obtained. The litopenaeus setiferus protein SF-P9 and the litopenaeus setiferus protein F-P6 have obvious biological activities of antibacterial infection, antimycotics infection, and anti-virus infection, as well as have an obvious effect of inhibiting tumor cell growth. Besides, the litopenaeus setiferus protein SF-P9 and the litopenaeus setiferus protein F-P6 can be applied to prepare medicaments for treating or preventing bacteria infection, fungi infection and virus infection and to prepare antitumor drugs.

Description

Technical field [0001] The invention relates to the fields of genetic engineering technology, medicine, and animal and plant disease prevention and control. More specifically, it relates to a recombinant genetically engineered strain containing the shrimp peptide gene penaeidine Pichia pastoris X-33 / pPIC6αA / Pen, the amino acid sequence of a recombinant prawn protein SF-P9 and its corresponding DNA sequence, the amino acid sequence of a prawn protein F-P6 and its corresponding DNA sequence, and the prawn protein SF-P9 And F-P6 pharmaceutical composition. It also relates to a yeast recombinant genetically engineered strain expressing recombinant prawn protein SF-P9 Pichia pastoris The construction method of X-33 / pPIC6αA / Pen. The shrimp proteins SF-P9 and F-P6 involved in the present invention have obvious biological activity against Gram-positive and Gram-negative bacterial infections, as well as anti-fungal infections. And the biological activity of anti-viral infection, but a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/435C12N15/12C12N1/19C12N15/09A61K38/17A61P31/04A61P31/10A61P31/12A61P35/02
Inventor 徐进平孟小林王健唐检秀
Owner HUBEI TAIYANGHONG BIOLOGICAL TECH CO LTD