Pig IFN (interferon) gamma-Fc fusion protein as well as coding gene and expression method of pig IFN (interferon) gamma-Fc fusion protein
A technology of fusion protein and protein sequence, which is applied in the field of genetic engineering and bioengineering, can solve the problems of complex renaturation process, high production cost, and inactivity of inclusion bodies, so as to increase the overall immune regulation effect, increase the time of effect, and reduce the The effect of production costs
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] Embodiment 1, the cDNA gene design of porcine IFNγ-Fc fusion protein
[0044] According to the cDNA sequence of Sus scrofa breed Fengjing interferon gamma that GenBank has published (GenBank sequence accession number: EU249804.1), the Fc fragment tag is added before the stop codon at the 3' end of the sequence, and the gene of the Fc fragment is provided by Sus scrofa The IgG heavy chain (GenBank accession number: NM_213828.1) consists of the cDNA sequences of the hinge region, CH2 region and CH3 region, and the obtained sequence is recorded as the original gene sequence of porcine IFNγ-Fc. According to the characteristics of the silkworm expression system, the gene sequence was optimized as a whole, and the optimized gene sequence was recorded as the first optimized gene sequence of pig IFNγ-Fc , As shown in SEQ ID NO:1.
[0045] The optimized first optimized gene sequence of porcine IFNγ-Fc is more suitable for the silkworm expression system, which is mainly reflec...
Embodiment 2
[0055] Example 2. Construction of recombinant transfer vector pFastBac-(IFNγ-Fc)
[0056] 1. PCR amplification of the second optimized gene product of porcine IFNγ-Fc
[0057] Using the artificially synthesized pVL1393-(IFNγ-Fc) plasmid as a template, carry out PCR amplification to remove the 23 amino acid signal peptide of IFNγ itself, and add the system gp64 signal peptide suitable for the insect expression system. The obtained gene sequence is marked as porcine IFNγ- The second optimized Fc gene, the gene sequence is shown in SEQ ID NO:2. details as follows:
[0058] Use primers as follows:
[0059] Forward primer 1: 5'-
[0060] CGC GGATCC ATGGTAAGCGCTATTGTTTTATATGTGCTTTTGGCGGCGGCGGCGCATTCTGCCTTTGCGCAAGCCCCTTTCTTCAAAGA-3',
[0061] Reverse primer 1: 5'-CCC AAGCTT TTATTTTTCCTTGGGTCTTGCT-3'.
[0062] The upstream primer contains a BamH I restriction site and the gp64 signal peptide sequence, and the downstream primer contains a Hind III restriction site.
[0063]...
Embodiment 3
[0075] Example 3, Construction of Baculovirus BmN-(IFNγ-Fc)
[0076] 1. Construction of transfer plasmid Bacmid-(IFNγ-Fc)
[0077] Add 5 μL of pFastBac-(IFNγ-Fc) plasmid into 100 μL of DH10Bac competent cells, heat shock in a water bath at 42°C for 90 seconds after 30 minutes on ice. After the heat shock, the product was quickly cooled on ice for 3 minutes, and then added to 900mL LB medium that had been incubated to 37°C, and revived at 37°C with shaking at 220rpm for 1h. Take 100 μL of recovered bacterial solution and spread it on the LB solid plate containing 50 μg / mL kanamycin, 7 μg / mL gentamycin, 10 μg / mL tetracycline, 100 μg / mL X-gal and 40 μg / mL IPTG at 37 Cultivate in an upside-down incubator. After 48 hours, a single white colony was picked from the LB solid plate and added to LB liquid medium containing 50 μg / mL kanamycin, 7 μg / mL gentamicin, and 10 μg / mL tetracycline for overnight expansion. After extracting Bacmid genomic DNA, PCR verification was performed us...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
