Recombinant bacillus displaying GCRV VP7 proteins on surface of bacillus subtilis GC5 and preparation method
A Bacillus subtilis, surface display technology, applied in the biological field, can solve the problem of immune antigen instability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0058] Cloning, sequencing and identification of GCRV VP7 gene.
[0059] (1) Grass carp samples that died due to GCRV infection were collected from Hefei City, Anhui Province. The heads, kidneys and intestines of the diseased fish were taken, cut into small pieces, ground in a homogenizer with PBS, and then repeatedly frozen at -80°C / 28°C Melt 3 times, filter with lens tissue, centrifuge at 1500 rpm for 10 min, take supernatant virus solution, and centrifuge at 8000 rpm for 30 min. The supernatant was sterilized by filtration through a 0.22 μm filter membrane to obtain a crude virus extract. Total RNA was extracted using the TRizol (Invitrogen) method, and cDNA was obtained using a reverse transcription kit (Promega).
[0060] (2)) According to the nucleic acid sequence of GCRV VP7 (Genebank sequence number: HQ231206) of the current epidemic strain type II, the following sequence was designed and synthesized:
[0061] vp7-F:5'-CGC GGATCC ATGGCGGGTGTGTCTCTCAAC-3'
[0062] ...
Embodiment 2
[0069] wild type Bacillus subtilis Bacillus subtilis Isolation and Characterization of GC5.
[0070] (1) Purchase several live grass carp from the market; take out the intestinal tract and cut it longitudinally, rinse twice with PBS and once with sterile water, scrape the intestinal mucosal wall and place the scraped material in new PBS Medium, diluted appropriately, treated at 80°C for 20 min, coated with TSA plate, and incubated overnight at 37°C. Pick colonies similar to Bacillus on the plate and culture them in TSB, then use the 16S RNA universal primers of Gram-positive bacteria to amplify and sequence, and compare the sequencing results with BLAST in NCBI, analyze the comparison results, and draw multiple times line, purified strains.
[0071] (2) pass gyrB , wxya , pho Gene sequence alignment and a series of physiological and biochemical (Gram's staining, catalase, aerobicity, gelatin liquefaction, starch hydrolysis, methyl red, citrate utilization experiments...
Embodiment 3
[0073] Construction of recombinant integrated vector for fusion expression:
[0074] (2) The recombinant plasmid is pMD-M plasmid (constructed for this laboratory, with pMD-19T simple (TAKARA) as the mother body, and the enzyme cutting sites are NheI, SmaI, KpnI, NotI, XhoI, BamHI, XbaI, HindIII, ScaI) were built for the platform. The pMD-M plasmid construction process: design primers based on the GFP fragment (GenBank: LC008492.1) on the pTurboGFP plasmid, and add NheI, SmaI, KpnI, NotI, and XhoI restriction sites to the upstream primers, and add BamHI and XbaI to the downstream primers , HindIII, ScaI restriction sites, the primer sequences are as follows:
[0075] GFP-F: GCTAGCCCCGGGGGTACCGCGGCCGCCTCGAGATGGTGAGCAAGGGCG
[0076] GFP-R:AGTACTAAGCTTTCTAGAGGATCCTTACTTGTACAGCTCGTCCATG
[0077] Using GFP-F and GFP-R as primers and pTurboGFP plasmid as a template, the GFP gene fragment was amplified. The PCR reaction program was: denaturation at 94°C for 5 min; 30 sec at 94°C, ...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com