Recombinant bacillus displaying GCRV VP7 proteins on surface of bacillus subtilis GC5 and preparation method

A Bacillus subtilis, surface display technology, applied in the biological field, can solve the problem of immune antigen instability

Active Publication Date: 2015-04-29
INST OF AQUATIC LIFE ACAD SINICA
View PDF4 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the characteristics of strong stress resistance, easy storage, easy preparation, easy large-scale production and good stability in water environment, the spores solve the problem of instability of GCRV VP7 protein as an immune antigen in extreme environments

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant bacillus displaying GCRV VP7 proteins on surface of bacillus subtilis GC5 and preparation method
  • Recombinant bacillus displaying GCRV VP7 proteins on surface of bacillus subtilis GC5 and preparation method
  • Recombinant bacillus displaying GCRV VP7 proteins on surface of bacillus subtilis GC5 and preparation method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] Cloning, sequencing and identification of GCRV VP7 gene.

[0059] (1) Grass carp samples that died due to GCRV infection were collected from Hefei City, Anhui Province. The heads, kidneys and intestines of the diseased fish were taken, cut into small pieces, ground in a homogenizer with PBS, and then repeatedly frozen at -80°C / 28°C Melt 3 times, filter with lens tissue, centrifuge at 1500 rpm for 10 min, take supernatant virus solution, and centrifuge at 8000 rpm for 30 min. The supernatant was sterilized by filtration through a 0.22 μm filter membrane to obtain a crude virus extract. Total RNA was extracted using the TRizol (Invitrogen) method, and cDNA was obtained using a reverse transcription kit (Promega).

[0060] (2)) According to the nucleic acid sequence of GCRV VP7 (Genebank sequence number: HQ231206) of the current epidemic strain type II, the following sequence was designed and synthesized:

[0061] vp7-F:5'-CGC GGATCC ATGGCGGGTGTGTCTCTCAAC-3'

[0062] ...

Embodiment 2

[0069] wild type Bacillus subtilis Bacillus subtilis Isolation and Characterization of GC5.

[0070] (1) Purchase several live grass carp from the market; take out the intestinal tract and cut it longitudinally, rinse twice with PBS and once with sterile water, scrape the intestinal mucosal wall and place the scraped material in new PBS Medium, diluted appropriately, treated at 80°C for 20 min, coated with TSA plate, and incubated overnight at 37°C. Pick colonies similar to Bacillus on the plate and culture them in TSB, then use the 16S RNA universal primers of Gram-positive bacteria to amplify and sequence, and compare the sequencing results with BLAST in NCBI, analyze the comparison results, and draw multiple times line, purified strains.

[0071] (2) pass gyrB , wxya , pho Gene sequence alignment and a series of physiological and biochemical (Gram's staining, catalase, aerobicity, gelatin liquefaction, starch hydrolysis, methyl red, citrate utilization experiments...

Embodiment 3

[0073] Construction of recombinant integrated vector for fusion expression:

[0074] (2) The recombinant plasmid is pMD-M plasmid (constructed for this laboratory, with pMD-19T simple (TAKARA) as the mother body, and the enzyme cutting sites are NheI, SmaI, KpnI, NotI, XhoI, BamHI, XbaI, HindIII, ScaI) were built for the platform. The pMD-M plasmid construction process: design primers based on the GFP fragment (GenBank: LC008492.1) on the pTurboGFP plasmid, and add NheI, SmaI, KpnI, NotI, and XhoI restriction sites to the upstream primers, and add BamHI and XbaI to the downstream primers , HindIII, ScaI restriction sites, the primer sequences are as follows:

[0075] GFP-F: GCTAGCCCCGGGGGTACCGCGGCCGCCTCGAGATGGTGAGCAAGGGCG

[0076] GFP-R:AGTACTAAGCTTTCTAGAGGATCCTTACTTGTACAGCTCGTCCATG

[0077] Using GFP-F and GFP-R as primers and pTurboGFP plasmid as a template, the GFP gene fragment was amplified. The PCR reaction program was: denaturation at 94°C for 5 min; 30 sec at 94°C, ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a recombinant bacillus displaying GCRV VP7 proteins on the surface of bacillus subtilis GC5 and a preparation method. The preparation method comprises the following steps: (1) obtaining a present epidemic strain type-II GCRV VP7 nucleotide sequence; (2) separating wide bacillus from the body of a grass carp, determining the wide bacillus to be bacillus subtilis, and naming the wide bacillus as Bacillus subtilis GC5, CCTCC NO: M2014654; (3) constructing a fusion expression recombinant integrated carrier, wherein a vp7 sequence in recombinant plasmids is the nucleotide sequence shown in SEQ ID No. 1; (4) preparing and authenticating recombinant bacillus subtilis, CCTCC NO: M2014655; (5) inducing and authenticating the recombinant bacillus displaying VP7 on the surface. The generation rate of spores is up to 100%, and the recombinant bacillus is simple and convenient to produce, low in cost, and capable of being used as a feed additive; the recombinant bacillus has an intestinal customization capacity, as well as is beneficial to regulating the intestinal bacterial colony balances of animals, improving the body immunocompetence of the animals, and enhancing the nutrition metabolism functions of the animals. The spores are high in stress resistance and easy for large-scale production, as well as solve the problem of instability of GCRV VP7 proteins used as immunizing antigens in extreme environments.

Description

technical field [0001] The invention belongs to the field of biotechnology, and more specifically relates to a recombinant spore displaying GCRV VP7 protein on the surface of Bacillus subtilis GC5, and also relates to a preparation method of the recombinant spore displaying GCRV VP7 protein on the surface of Bacillus subtilis GC5. Background technique [0002] grass carp( Ctenopharynodon idellus ), as one of the four major domestic fishes in my country, is a kind of economic fish widely raised in my country and has important economic value. Grass carp reovirus (GCRV) is one of the main pathogens causing grass carp hemorrhagic disease, which seriously affects the healthy development of grass carp aquaculture. Due to the reassortment of gene segments and antigenic drift among virus strains in different regions, the isolated GCRV strains can be divided into 3 types (types I, II, and III), of which type II is currently the main epidemic strain (Zeng Weiwei et al. Grass carp Es...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12N15/75C12N15/46C12R1/125
CPCC07K14/005C07K14/32C12N2720/12022
Inventor 张永安陈丹丹郭霞
Owner INST OF AQUATIC LIFE ACAD SINICA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap