Notoginseng class sweet protein gene PnTLP5 and application thereof

[0019] Example 1: PnTLP 5 Full-length gene cloning and sequence analysis

[0020] Take the three-year-old Panax notoginseng leaves to extract total RNA, grind the Panax notoginseng leaves into powder with liquid nitrogen, then transfer them into a centrifuge tube, use the guanidine isothiocyanate method to extract total RNA, and use reverse transcriptase M-MLV (promega) to Total RNA is used as the template to synthesize the first strand of cDNA. The reaction system and operation process are as follows: Take 5 μg Total RNA, add 50 ng oligo (dT), 2 μL dNTP (2.5 mM each), DEPC water to the reaction volume to 14.5 μL; After mixing, heat and denature at 70°C for 5 minutes and then quickly cool on ice for 5 minutes, then add 4 μL 5×First-stand buffer, 0.5 μL RNasin (200U), 1 μL M-MLV (200U), and mix well. Centrifuge for a short time, warm bath at 42°C for 1.5 h, take it out and heat at 70°C for 10 min to terminate the reaction. After the first strand of cDNA is synthesized, it is stored at -20°C for later use.

[0021] Use the synthesized first-strand cDNA as a template to amplify the target gene PnTLP5 , The upstream and downstream primer sequences used are 5'TTGTCAACTTAAACAATATGAGCTA3' and 5'AACCTTTTAACTTATTGGAACTGCT3' respectively. Adopt Advantage TM 2 PCR Enzyme (Clontech) amplifies the target gene; PCR reaction conditions: 95°C 2 min; 95°C 30 s, 57°C 30s, 72°C 1 min, 30 cycles; 72°C 10 min; reaction system (20 μL) It is 1 μL cDNA, 2 μL 10×Advantage 2 PCR Buffer, 1.8 μL 50×dNTP Mix (10mM each), 0.2 μL forward primer (10 μM), 0.2 μL reverse primer (10 μM), 0.2 μL Advantage 2 PCR Polymerase Mix, 14.6 μL PCR-Gradewater; after PCR, take 5 μL for agarose gel electrophoresis to detect the specificity and size of the amplified product.

[0022] The result of agarose gel electrophoresis showed that the PCR product had only one DNA band, so the PCR product was directly cloned by TA. The kit used was pMD18-T vector kit (Dalian Bao Bio), the reaction system and operation process were: take 1.5 μL of PCR product , Add 1 μL pMD18-T vector (50 ng/μL) and 2.5 μL 2×Ligation solution I in sequence, mix well and place at 16°C overnight for reaction. The ligation product was transformed into E. coli DH5α by heat shock transformation method. Use LB solid medium containing ampicillin (Ampicillin, Amp) to screen positive clones, select several single colonies, and expand after shaking PnTLP5 Specific primers identify multiple cloning site insertions PnTLP5 Clones, sequence the identified clones, and finally obtain PnTLP5 The full-length cDNA is 1170 bp, and it is found by NCBI ORF finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html) that it contains an open reading frame of 726 bp (see sequence table). PnTLP 5 encodes a protein PnTLP5 containing 241 amino acids, with a protein molecular mass of 26.4 kD and an isoelectric point (pI) of 7.75, indicating that the protein is a basic protein. Including 16 acidic amino acids (D, E), 19 basic amino acids (K, R, H), 113 hydrophobic amino acids and 89 hydrophilic amino acids. Using SMART to analyze the gene structure, it was found that PnTLP5 has a possible signal peptide.

[0023] Example 2: Plant overexpression vector construction

[0024] Use SanPrep column plasmid DNA small extraction kit (Shanghai Shenggong) to extract inserts PnTLP5 Escherichia coli plasmid pMD-18T- PnTLP5 And the plasmid of the plant expression vector pCAMBIA2300s, take 1 μL for agarose gel electrophoresis to check the integrity and concentration of the extracted plasmid; use restriction enzymes Bam HI (TaKaRa) and Eco RI (TaKaRa) was used for plasmid pMD-18T- PnTLP5 Double enzyme digestion with pCAMBIA2300s (100 μL system), the reaction system and operation process are: take 20 μL pMD-18T- PnTLP5 And pCAMBIA2300s plasmid, sequentially add 10 μL 10×K buffer, 5 μL Bam HI, 5 μL Eco RI, 60 μL ddH 2 O, centrifuge for a short time after mixing, and place it at 37°C overnight for reaction; spot all digested products on agarose gel for electrophoresis, and then PnTLP5 The fragment and the large fragment of pCAMBIA2300s vector were separately recovered by gel; 1 μL of the recovered product was collected by agarose gel electrophoresis to detect the size and concentration of the recovered fragment, and stored at -20°C for later use.

[0025] Using T4 DNA Ligase (TaKaRa), the recovered PnTLP5 The DNA fragment and pCAMBIA2300s vector fragment are connected, the reaction system (20 μL) and operation process are: take 10 μL PnTLP5 Add 2 μL pCAMBIA2300s vector DNA, 2 μL 10×T4 DNA Ligase Buffer, 1 μL T4 DNA Ligase, 5 μL ddH to the DNA fragments in sequence 2 O, centrifuge for a short time after mixing, and then react overnight at 16°C in a water bath. Then the ligation product was transformed into E. coli DH5α by heat shock transformation method, and positive clones were selected with solid medium containing 50 mg/L Kanamycin (Km). Select a single colony of shaking bacteria, and use the bacterial solution as a template for amplification PnTLP5 PCR with specific primers to select PnTLP5 For clones successfully connected to pCAMBIA2300s, if the tested strain is positive, add glycerol and store at -80°C for later use.

[0026] The SanPrep column plasmid extraction kit was used to extract and purify the pCAMBIA2300s- PnTLP5 Plasmid. The plant expression vector pCAMBIA2300s- PnTLP5 Transform into Agrobacterium tumefaciens LBA4404 competent cells. The operation steps are: take 2 μg pCAMBIA2300s- PnTLP5 The plasmid was added to a centrifuge tube containing 200 μL of competent cells, mixed gently, then ice-bathed for 5 min, then transferred to liquid nitrogen for 1 min, then quickly placed in a 37℃ water bath for 5 min, and then immediately ice-bathed for 2 min. Add 800 μL LB liquid medium and shake culture at 28°C for 4h. The activated Agrobacterium was spread on LB solid medium containing 50 mg/L Km and cultured at 28°C. Select single colony shake bacteria, and then use amplification PnTLP5 PCR with specific primers to detect pCAMBIA2300s- PnTLP5 Whether it is transferred to Agrobacterium. For positive clones, add glycerol and store at -80°C for later use.

[0027] Example 3: Agrobacterium-mediated plant genetic transformation and transgenic plant screening

[0028] The transgenic recipient in this experiment is tobacco. Tobacco seeds are soaked in 75% alcohol for 30s, washed with sterile water and then washed with 0.1% HgCl 2 Soak for 8 min, then wash several times with sterile water, sown on 1/2 MS medium, cultivate in the dark at 28°C for 6 d, and transfer to a light incubator (25°C, 16h/d light) after germination. Subculture once a month with 1/2MS medium.

[0029] Take out the preserved pCAMBIA2300s- PnTLP5 The plasmid Agrobacterium LBA4404 strain was inoculated in 5 mL of LB liquid medium containing 50 mg/L Km and 20 mg/L rifampicin, and cultured at 28°C until the medium became turbid. Pipette 1 mL of the turbid bacterial liquid onto the LB solid medium containing 50 mg/L Km, and incubate at 28°C for 48 h; then scrape off the Agrobacterium on the LB solid medium and inoculate it with 20 mg/L acetyl. In the MGL liquid medium of syringone, culture with shaking at 28°C for 2-3 h to activate Agrobacterium.

[0030] Take the tobacco aseptic seedling leaves and cut into 1 cm 2 The left and right leaf discs are completely immersed in the above-mentioned MGL liquid medium containing activated Agrobacterium for 15 min. Use sterile filter paper to absorb the bacterial liquid on the leaf disc surface, and place the leaf discs on the co-culture medium for room temperature Cultivation, the co-medium for tobacco transformation is MS+0.02 mg/L 6-BA+2.1 mg/L NAA+30 g/L sucrose+6 g/L agar, co-cultivation for 2 days at 22°C without light.

[0031] The co-cultured leaf discs were transferred to MS selection medium with antibiotics to differentiate into shoots, and transgenic plants were screened at the same time. Tobacco selection medium is MS+0.5 mg/L 6-BA+0.1 mg/L NAA+30 g/L sucrose+6 g/L agar+50mg/L Km+200 mg/L cephalosporin (Cefotaxime sodium salt, Cef); during screening culture, transfer the culture flask to a light incubator for culture (25°C, 16h/d light, 8h/d dark), after the tobacco shoots out, use MS containing 50 mg/L Km and 200 mg/L Cef. Base subculture, and finally select regenerated seedlings with better roots for PCR detection.

[0032] The genomic DNA of the leaves of transgenic tobacco plants was extracted by the CTAB method, and 1 μL of the extracted genomic DNA was tested by agarose gel electrophoresis for its integrity and concentration. The genomic DNA of the transgenic plants was used as a template for amplification PnTLP5 PCR was carried out with specific primers for PCR. After PCR, 8μL of the product was used for agarose gel electrophoresis to detect positive transgenic plants. The amplification results of some tobacco transgenic plants are as follows figure 1 As shown, PnTLP5 A total of 30 positive transgenic plants were screened for transgenic tobacco.