Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

P-hydroxybenzoate hydroxylase for diagnosis, and preparation method and application of p-hydroxybenzoate hydroxylase for diagnosis

A hydroxybenzoate hydroxylase and amino acid technology is applied in the field of genetic engineering to achieve the effects of high purity, high analytical sensitivity and cost reduction

Active Publication Date: 2020-06-26
HUNAN NEWLAND BIOTECH
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] The gene of paraben hydroxylase has been sequenced in various microorganisms, and its crystal structure and enzyme function have been studied, such as in Pseudomonas, Acinetobacter, Comamonas Paraben hydroxylases have been found in the genera Comamonas, Rhodococcus, and Cupriavidus, but not so far in Pseudomonas stutzeri Report on Benzoate Hydroxylase

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • P-hydroxybenzoate hydroxylase for diagnosis, and preparation method and application of p-hydroxybenzoate hydroxylase for diagnosis
  • P-hydroxybenzoate hydroxylase for diagnosis, and preparation method and application of p-hydroxybenzoate hydroxylase for diagnosis
  • P-hydroxybenzoate hydroxylase for diagnosis, and preparation method and application of p-hydroxybenzoate hydroxylase for diagnosis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1 PCR amplification and sequencing analysis of p-hydroxybenzoic acid hydroxylase gene PHBH

[0031] 1. Extraction of RNA

[0032] Extraction was carried out according to the method of OMEGA bacterial RNA kit.

[0033] (1) Take 3mL bacterial cells of Pseudomonas stutzeri (Pseudomonas stutzeri, GDMCC No.1.273, purchased from Guangdong Microbial Culture Collection Center), centrifuge and precipitate on a 6000g centrifuge at 4°C for 5 minutes, discard the supernatant, Add 500 μL of 1×TE Buffer, pipette evenly with a pipette tip, centrifuge at 4°C on a 6000g centrifuge for 5 minutes, and discard the supernatant;

[0034] (2) Add 100 μL of TE Buffer (20 mg / mL) dissolved in lysozyme, resuspend the bacteria, and vortex for 30 seconds;

[0035] (3) 30°C water bath for 10 minutes, vortex shaking for 20 seconds every 2 minutes;

[0036] (4) Add 350 μL of BRKBuffer (before the first use, add β-mercaptoethanol to make the concentration 20 mg / mL), add 25-40 mg of glass pow...

Embodiment 2

[0062] Recombinant expression of embodiment 2 p-hydroxybenzoic acid hydroxylase

[0063] (1) Synthesis of p-hydroxybenzoate hydroxylase gene PHBH

[0064] Using the cDNA of the p-hydroxybenzoic acid hydroxylase gene PHBH as a template, two primers were designed and synthesized for PCR amplification.

[0065] The primer sequences are:

[0066] PHBH-NdeI-Forward: CCGCATATGAAAACCCAAGTCGCGATT (SEQ ID No. 5)

[0067] PHBH-HindⅢ-Reverse: CCCAAGCTTCTACTCAATCTCCTCATACGGC (SEQ ID No. 6)

[0068] Reaction conditions:

[0069]

[0070] PCR reaction program: 94°C x 3 minutes, then perform (94°C x 30 seconds → 55°C x 30 seconds → 72°C x 1 minute) x 30 cycles, then keep at 72°C for 10 minutes, then cool down to 4°C for storage.

[0071] The PCR product was recovered by a PCR product purification kit.

[0072] (2) Construction of p-hydroxybenzoate hydroxylase gene PHBH recombinant vector

[0073] After the p-hydroxybenzoate hydroxylase gene PHBH and the vector pET-28a were digested ...

Embodiment 3

[0105] Application of embodiment 3 p-hydroxybenzoic acid hydroxylase in cholinesterase assay

[0106] The prepared p-hydroxybenzoic acid hydroxylase is formulated into a cholinesterase (CHE) assay kit for the determination of cholinesterase activity in serum or plasma, and for auxiliary diagnosis of liver function.

[0107] Preparation of cholinesterase assay reagents:

[0108] Main components of R1 liquid reagent: NADPH (reduced form) ≥ 0.24mmol / L;

[0109] Main components of R2 liquid reagent: choline p-hydroxybenzoate≥2.84mmol / L, p-hydroxybenzoate hydroxylase≥160U / dL, 3,4-dihydroxybenzoate oxygenase≥60U / dL.

[0110] In this example, the Toshiba TBA-120FR automatic biochemical analyzer is used to measure the kit. The operation process is as follows: first add the calibrator or sample, then add the R1 reagent and pre-incubate for 5 minutes, read the absorbance A1, and then add the reagent R2 to react for 5 minutes , the reaction temperature is 37°C, the main wavelength is 3...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses p-hydroxybenzoate hydroxylase for diagnosis, and a preparation method and application of the p-hydroxybenzoate hydroxylase for diagnosis, and belongs to the technical field ofgenetic engineering. A nucleotide sequence for coding a gene of the p-hydroxybenzoate hydroxylase is as shown in SEQID No.1, and an amino acid sequence of the p-hydroxybenzoate hydroxylase is as shownin SEQID No.2; and the p-hydroxybenzoate hydroxylase can be obtained from pseudomonas stutzeri through cloning and expression, and can be used for detecting the content of cholinesterase in human serum / plasma. The prepared p-hydroxybenzoate hydroxylase disclosed by the invention has the advantages of being high in purity, good in activity, high in yield, low in cost and the like, and is easy to promote and apply.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and specifically relates to a new p-hydroxybenzoic acid hydroxylase, its preparation method and its application in in vitro diagnostic reagents. Background technique [0002] Cholinesterase (Cholin esterase, CHE) is a class of enzymes that catalyze the hydrolysis of acylcholine, a hydrolase that exists in serum or plasma in the form of multiple isozymes. There are two kinds of cholinesterase in the human body, one is acetylcholinesterase, also known as "true cholinesterase" or "specific cholinesterase", which mainly acts on acetylcholine and exists in red blood cells and the gray matter of the central nervous system The other is serum cholinesterase, which has poor specificity. In addition to being used for acetylcholine, it can also act on other choline esters, so it is also called "pseudocholinesterase" or "non-specific cholinesterase". This enzyme is mainly produced by the liver. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/02C12N15/53C12N15/70C12Q1/46C12Q1/26
CPCC12N9/0073C12N15/70C12Q1/46C12Q1/26G01N2333/918G01N2333/90251Y02A50/30
Inventor 李本涛黄任平李仕亮
Owner HUNAN NEWLAND BIOTECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com