Manganese oxidizing fungus and application thereof
A manganese oxidizing and fungi technology, applied to manganese oxidizing fungi and its application fields, can solve the problems of nutrient-deficient microorganisms, affecting the survival of strains, manganese oxidizing activity, etc., and achieve the effect of great application potential.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Isolation and Purification of Manganese Oxidizing Bacteria Cladosporium sp.XM01 Strain
[0031] Cladosporium sp.XM01 was obtained from the manganese ore piled soil in Xiangtan, Hunan, after domestication, separation and purification. Specific steps are as follows:
[0032] (1) Preliminary screening: collect dark brown soil from near Hunan Xiangtan Manganese Mine, take 2g of soil in the laboratory, and add it to HAY medium (0.246g / L sodium acetate; 0.15g) sterilized by high temperature (115°C, 25min) / L yeast powder; 0.05g / L magnesium sulfate heptahydrate; 5mg / L dipotassium hydrogen phosphate; 2mL / L mineral salt, mineral salt composition per liter: 3.7g calcium chloride dihydrate; 0.44g zinc sulfate heptahydrate ; 0.29g sodium molybdate dihydrate; 2.5g boric acid; 5mg copper sulfate pentahydrate; 1.0g ferric chloride hexahydrate), make MnCl 2 The content is 200μM, the buffer in the medium is HEPES with a final concentration of 20mM, and the pH is 7.0; where MnCl 2 The...
Embodiment 2
[0036] Molecular Biological Identification of Cladosporium sp.XM01
[0037] Cladosporium XM01 was extracted using the Fungal Genome Kit (purchased from Omega, Code no. D3390-02). The fungal ITS rRNA gene universal primers ITS1 (TCCGTAGGT GAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) were used for PCR amplification. The PCR reaction system is:
[0038]
[0039] PCR amplification program:
[0040]
[0041] Sequence determination was carried out by sending the amplified PCR product for sequencing, and the sequencing was completed by Shanghai Meiji Biomedical Technology Co., Ltd. The sequence obtained by sequencing, as shown in SEQ ID NO.1, was compared with the sequence in the database using BLAST online, and the sequence with a similarity greater than 97% was selected as the reference sequence, and the fungal system was constructed using Neighbor-Joining using Mega4.0 software developmental tree (eg figure 1 ).
Embodiment 3
[0043] Scanning Electron Microscopy (SEM) and Energy Spectrum Analysis (EDX) of Cladosporium sp.XM01 Strain
[0044] The isolated Cladosporium XM01 was inoculated into Mn-containing 2+ HAY liquid medium (the inoculum size was 1×10 5 conidia / mL), and cultured at 25°C and 170rpm in the dark for 3 days, the biomanganese oxides were collected for scanning electron microscope observation and energy spectrum analysis. The results of scanning electron microscopy combined with energy dispersive spectroscopy were as follows: image 3 And shown in table 1, wherein mark 1 is the aggregate that contains manganese oxide, and mark 2 is the mycelia surface without manganese oxide, and higher manganese oxide can be detected at mark 1 on the thalline of Cladosporium XM01 content, up to 30.81%, compared with mark 2, the content of manganese increased by 25.68%. It can be seen that the strain XM01 can form manganese oxide aggregates on the exine of the spore, which may participate in the oxid...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap