Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Manganese oxidizing fungus and application thereof

A manganese oxidizing and fungi technology, applied to manganese oxidizing fungi and its application fields, can solve the problems of nutrient-deficient microorganisms, affecting the survival of strains, manganese oxidizing activity, etc., and achieve the effect of great application potential.

Active Publication Date: 2021-05-25
TONGJI UNIV
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Under natural water quality conditions, there are nutrient deficiencies and microbial competition, which will affect the survival and manganese oxidation activity of the strains

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Manganese oxidizing fungus and application thereof
  • Manganese oxidizing fungus and application thereof
  • Manganese oxidizing fungus and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Isolation and Purification of Manganese Oxidizing Bacteria Cladosporium sp.XM01 Strain

[0031] Cladosporium sp.XM01 was obtained from the manganese ore piled soil in Xiangtan, Hunan, after domestication, separation and purification. Specific steps are as follows:

[0032] (1) Preliminary screening: collect dark brown soil from near Hunan Xiangtan Manganese Mine, take 2g of soil in the laboratory, and add it to HAY medium (0.246g / L sodium acetate; 0.15g) sterilized by high temperature (115°C, 25min) / L yeast powder; 0.05g / L magnesium sulfate heptahydrate; 5mg / L dipotassium hydrogen phosphate; 2mL / L mineral salt, mineral salt composition per liter: 3.7g calcium chloride dihydrate; 0.44g zinc sulfate heptahydrate ; 0.29g sodium molybdate dihydrate; 2.5g boric acid; 5mg copper sulfate pentahydrate; 1.0g ferric chloride hexahydrate), make MnCl 2 The content is 200μM, the buffer in the medium is HEPES with a final concentration of 20mM, and the pH is 7.0; where MnCl 2 The...

Embodiment 2

[0036] Molecular Biological Identification of Cladosporium sp.XM01

[0037] Cladosporium XM01 was extracted using the Fungal Genome Kit (purchased from Omega, Code no. D3390-02). The fungal ITS rRNA gene universal primers ITS1 (TCCGTAGGT GAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) were used for PCR amplification. The PCR reaction system is:

[0038]

[0039] PCR amplification program:

[0040]

[0041] Sequence determination was carried out by sending the amplified PCR product for sequencing, and the sequencing was completed by Shanghai Meiji Biomedical Technology Co., Ltd. The sequence obtained by sequencing, as shown in SEQ ID NO.1, was compared with the sequence in the database using BLAST online, and the sequence with a similarity greater than 97% was selected as the reference sequence, and the fungal system was constructed using Neighbor-Joining using Mega4.0 software developmental tree (eg figure 1 ).

Embodiment 3

[0043] Scanning Electron Microscopy (SEM) and Energy Spectrum Analysis (EDX) of Cladosporium sp.XM01 Strain

[0044] The isolated Cladosporium XM01 was inoculated into Mn-containing 2+ HAY liquid medium (the inoculum size was 1×10 5 conidia / mL), and cultured at 25°C and 170rpm in the dark for 3 days, the biomanganese oxides were collected for scanning electron microscope observation and energy spectrum analysis. The results of scanning electron microscopy combined with energy dispersive spectroscopy were as follows: image 3 And shown in table 1, wherein mark 1 is the aggregate that contains manganese oxide, and mark 2 is the mycelia surface without manganese oxide, and higher manganese oxide can be detected at mark 1 on the thalline of Cladosporium XM01 content, up to 30.81%, compared with mark 2, the content of manganese increased by 25.68%. It can be seen that the strain XM01 can form manganese oxide aggregates on the exine of the spore, which may participate in the oxid...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a fungus with manganese oxidation capacity, the fungus can oxidize Mn < 2 + > in a water body to generate manganese oxide insoluble in water, the Mn < 2 + > oxidizing fungus is Cladosporidium sp. XM01, and the preservation number is CGMCC NO.21083. The Cladosporium sp. XM01 strain is used for Mn < 2 + > oxidation in natural water, the operation temperature is stable (15-30 DEG C) and the pH value (6.0-7.5) is in a neutral range, so that the cladosporium XM01 strain has very high Mn < 2 + > oxidation efficiency; in-situ remediation of water and soil polluted by heavy metals or trace organic matters can be realized by adopting XM01 circulating the Mn (II); the manganese oxide generated by oxidation in the growth process of the strain has good application potential in the fields of sewage treatment, water environment remediation, soil and the like.

Description

technical field [0001] The invention relates to the technical field of environmental microorganisms, in particular to a manganese oxidizing fungus and its application. Background technique [0002] In recent years, due to the good adsorption capacity and oxidation capacity of biological manganese oxides, compared with chemically synthesized manganese oxides, biological manganese oxides have weak crystallization, small particle size, high Mn valence state, and many octahedral holes in the structure. It has stronger surface activity such as adsorption and oxidation. In addition, biomanganese oxide is produced under environmentally friendly conditions without excessive use of energy, so it can be considered as a cost-effective and environmentally friendly material for the remediation of polluted environments. [0003] The formation mechanism of manganese oxide has two kinds of chemical origin and biological origin. In contrast, biogenesis believes that microorganisms mainly m...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/14C02F3/34B09C1/10C02F101/20C12R1/645
CPCC12N1/14C02F3/347B09C1/105C02F2101/206C12N1/145C12R2001/645
Inventor 王美徐祖信董滨
Owner TONGJI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com