Bacillus coagulans BC66 and application thereof
A technology of Bacillus coagulans and BC66, which is applied in the field of microorganisms, can solve the problems of reduced safety of livestock or aquatic products, increased disease rate and mortality, and impact on animal growth performance, so as to improve the body's immunity and enhance intestinal function , the effect of strong ability to inhibit pathogenic bacteria
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] The screening of embodiment 1 bacillus coagulans BC66
[0029] Weikang Probiotics (Suzhou) Co., Ltd. has preserved more than 20,000 probiotic strains from different genera and species isolated from nature, among which 50 strains are Bacillus coagulans derived from the intestinal contents of healthy piglets. We obtained these Among the strains, a strain BC66 with particularly strong acid production ability was screened.
Embodiment 2
[0030] Embodiment 2 Bacillus coagulans BC66 physicochemical properties
[0031] Bacillus coagulans BC66, Gram-positive rod-shaped bacteria, catalase-positive, oxidase-negative, can form spores, and spores are terminal. The results of growth experiments showed that the strain could utilize α-D-glucose, D-mannose, gentian ditang, α-D-lactose, D-fructose, D-melibiose, D-trehalose, D-galactose, D-cellulose, D-fucose, L-fucose, L-rhamnose, D-maltose, Songertang, D-fructose-6-phosphate, glycine-L-proline, D- Galacturonic acid, D-gluconic acid, L-malic acid, L-galactonolactone, methyl pyruvate, D-gluconic acid aldehyde, D-mannitol, D-arabinitol, β-methyl -D-glucoside, N-acetyl-D-glucosamine, glucuronamide, N-acetyl-β-D-mannosamine, dextrin, glycerin, L-lactic acid. The results of chemical sensitivity experiments showed that the strain was resistant to troleandomycin, rifamycin SV, minocycline, vancomycin, sodium tetradecyl sulfate, tetrazolium blue, fusidic acid, lincomycin, Guani...
Embodiment 3
[0032] The 16S rRNA gene sequence determination result of embodiment 3 Bacillus coagulans BC66
[0033] Liquid expansion culture, collecting bacteria, extracting genomic DNA, using universal primers 27F: AGAGTTTGATCCTGGCTCAG (SEQ ID No 2) and 1492R: GGTTACCTTGTTACGACTT (SEQ ID No 3) to amplify its 16S rDNA fragment, and using agarose gel electrophoresis to detect PCR amplification. increase product. The obtained target fragments were sequenced and analyzed, and the sequencing results were compared and analyzed in the NCBI database. The obtained strain was identified as Bacillus coagulans, and its classification was named Bacillus coagulans. General Microbiology Center (CGMCC) of Species Collection Management Committee, address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, the preservation number is CGMCC21879, and the strain number is BC66.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap