Method for preparing human serum amyloid A1 and expression vector and genetic engineering bacteria thereof

A technology of genetically engineered bacteria and expression vectors, applied in the field of preparation of human serum amyloid A1 and its expression vectors and genetically engineered bacteria, can solve the problems of complicated purification methods, long time-consuming, low yield, etc., and achieve simplification of purification methods , avoid denaturation, low purification cost

Inactive Publication Date: 2010-06-09
DIASYS DIAGNOSTIC SYST SHANGHAI
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the in vitro recombinant expression and purification of SAA is due to its protein characteristics, such as its easy aggregation in vitro, low expression level, less soluble protein obtained, and complicated purification methods.
Therefore, the further development of SAA in vitro research has been limited for a long time.
The recombinant SAA protein obtained by these two methods is an inclusion body, so complex methods such as 6M urea or guanidine hydrochloride must be used in the purification process to denature and refold the purified target protein, so the purified recombinant protein has low biological activity. and unstable
In addition, this purification method takes a long time, has low yield and high cost, which is not conducive to mass production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing human serum amyloid A1 and expression vector and genetic engineering bacteria thereof
  • Method for preparing human serum amyloid A1 and expression vector and genetic engineering bacteria thereof
  • Method for preparing human serum amyloid A1 and expression vector and genetic engineering bacteria thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1. PCR amplification of the coding gene of human SAA1 and construction of recombinant expression plasmid pET28a(+)-SAA

[0035] The build steps are as follows:

[0036] 1) Extract total RNA:

[0037] Fresh patient liver tissue was taken, crushed with a homogenizer, and total RNA was extracted with an RNA extraction kit.

[0038] 2) PCR amplification of the target gene (RT-PCR):

[0039] Using the total RNA as a template, the cDNA of SAA1 was obtained by using a reverse transcription kit. Design a pair of primers according to the human SAA1 sequence published in the gene bank, the primers are:

[0040] Upstream primer: 5'AT CATATG TTCTTTTCGTTCCTTGGCGAG(Nde I);

[0041] Downstream primer: 5'AT CTCGAG TCAGTATTTCTCAGGCAGG (Xhol I).

[0042] The primers were designed with reference to the reported sequence of human SAA1, starting from the 60th nucleotide of cDNA to amplify the mature peptide gene of human SAA protein.

[0043] The following PCR reaction sys...

Embodiment 2

[0049] Example 2. Construction and screening of high-efficiency expression engineering bacteria

[0050] The recombinant plasmid pET-28(a)-SAA was transformed into Escherichia coli Rosetta-gami, and a single colony of the recombinant bacteria was inoculated in 3 ml of LB medium containing kanamycin, and cultured on a shaker at 37°C overnight. The next day, inoculate 2% of the overnight cultured recombinant engineered bacteria into 3ml LB medium, culture on a shaker at 37°C for about 2 hours until the OD600 is about 0.8, add IPTG to a final concentration of 1mM, and induce for 2.5 hours. 15% SDS-PAGE was used to detect the expression form and amount of the fusion protein, and to screen highly expressing strains. The results are shown in Table 2 below, with Figure 4a And attached Figure 4b . attached Figure 4a and 4b It shows that the results of the protein electrophoresis graph and the growth curve of the host bacteria show that after adding the inducer IPTG for a total...

Embodiment 3

[0055] Embodiment 3. Large-scale expression and purification method of gene recombinant bacteria

[0056] Expression of recombinant human SAA-polyhistidine fusion protein in Escherichia coli host ;

[0057] 1) Transform PET28a-saa1 into Rosetta-gami Escherichia coli on an LB culture plate with kanamycin resistance (50ng / ml), culture overnight at 37°C;

[0058] 2) Pick a single colony and culture it overnight at 37°C at 250 rpm in 50ml of LB culture containing 50μg / ml kanamycin;

[0059] 3) 2% inoculated into 1L LB medium (including 50ug / ml kanamycin), 37°C to A600, O.D.0.5;

[0060] 4) Add IPTG to a final concentration of 1mM at 37°C and induce culture at 300 rpm for 3 hours;

[0061] 5) Centrifuge at 4000 rpm for 20 minutes at high speed, collect the precipitate and store it at -80°C.

[0062] Reagent for Purifying Recombinant Human SAA-Polyhistidine Fusion Protein

[0063] 1) Lysis solution: 50mM Tris-HCl Ph 8.0, 500mM NaCl, 10mM imidazole, 1mMPMSF, 5mM 2-Me

[0064...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for preparing soluble genetic engineering human serum amyloid A1 (SAA1) and an expression vector and genetic engineering bacteria thereof. The expression vector provided by the invention is a plamid vector pET28a(+) containing a human SAA (hSAA1) gene sequence, and the hSAA1 encoding sequence is positioned between restriction enzyme cutting sites of NdeI and Xhol I on the pET28a(+) vector. The genetic engineering bacteria provided by the invention are colibacillus pET28a (+)-hSAA1 / Rosetta-gami, which can express soluble target protein. The preparation method of the invention uses a nickel cross-linking affinity-column one-step method, has simple operation, high yield and short consumed time, and is suitable for industrial large-scale production, and the purity of the obtained target protein is larger than 90%.

Description

technical field [0001] The present invention relates to the field of producing protein or polypeptide by DNA recombination technology, more specifically, the present invention relates to the method for preparing human serum amyloid A1 (Serum Amyloid A1, SAA1) through genetic engineering, and also relates to its expression vector and genetically engineered bacteria. Background technique [0002] Serum Amyloid A (SAA) is an acute phase response apolipoprotein, and the SAA gene is located on chromosome 11, which is a group of pleomorphic proteins encoded by the same cluster of genes. Human serum amyloid A1 (SAA1) consists of 104 amino acids with a molecular weight of about 12KD-14KD. SAA is a polymorphic protein consisting of several related protein families (SAA1-SAA4). Mainly synthesized by liver cells. Among them, the genes of SAA1 and SAA2 have only 7 amino acid differences, and they both encode the acute phase SAA protein. SAA4 is little changed in the acute phase respo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/63C12N1/21C12P21/02C12R1/19
Inventor吴峻王荣芳钱震斌
OwnerDIASYS DIAGNOSTIC SYST SHANGHAI