Pig IFNalpha1-Fc fusion protein as well as encoding gene and expression method thereof
A fusion protein, 1-fc technology, applied in the fields of genetic engineering and bioengineering, can solve the problems of complex renaturation process of inclusion bodies, inactivity, low protein specific activity, etc., to increase the overall immune regulation effect, reduce production costs, High bioactive effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] Example 1, cDNA gene design of porcine IFNα1-Fc fusion protein
[0044] According to the cDNA sequence of Sus scrofa interferon alpha1 published by GenBank (GenBank sequence accession number: EU364896.1), an Fc tag is added before the stop codon at the 3' end of the sequence, and the gene of the Fc fragment is composed of Sus scrofaIgG heavy chain ( GenBank accession number: NM_213828.1) consists of the cDNA sequences of the hinge region, CH2 region and CH3 region, and the obtained sequence is recorded as the original gene sequence of porcine IFNɑ1-Fc. According to the characteristics of the silkworm expression system, the gene sequence was optimized as a whole, and the optimized gene sequence was recorded as the first optimized gene sequence of porcine IFNɑ1-Fc, as shown in SEQ ID NO:1.
[0045] The optimized first optimized gene sequence of porcine IFNɑ1-Fc is more suitable for the silkworm expression system, which is mainly reflected in the following aspects:
[0...
Embodiment 2
[0055] Example 2. Construction of recombinant transfer vector pFastBac-(IFNɑ1-Fc)
[0056] 1. PCR amplification of the second optimized gene product of porcine IFNɑ1-Fc
[0057] Using the artificially synthesized pVL1393-(IFNɑ1-Fc) plasmid as a template, PCR amplification was performed to remove the 23 amino acid signal peptides carried by IFNɑ1 itself, and the system gp64 signal peptide suitable for the insect expression system was added. The obtained gene sequence was marked as porcine IFNɑ1- The second optimized Fc gene, the gene sequence is shown in SEQ ID NO:2. details as follows:
[0058] Use primers as follows:
[0059] Forward primer 1: 5'-
[0060] CGC GGATCC ATGGTAAGCGCTATTGTTTTATATGTGCTTTTGGCGGCGGCGGCGCATTCTGCCTTTGCGTGTGACCTGCCTCAGACCCA-3',
[0061] Reverse primer 1: 5'-CCC AAGCTT TCATTTTTCCTTGGGTCTTGC-3'.
[0062] The upstream primer contains a BamH I restriction site and the gp64 signal peptide sequence, and the downstream primer contains a Hind III res...
Embodiment 3
[0074] Example 3, Construction of Baculovirus BmN-(IFNɑ1-Fc)
[0075] 1. Construction of transfer plasmid Bacmid-(IFNɑ1-Fc)
[0076] Add 5 μL of pFastBac-(IFNɑ1-Fc) plasmid to 100 μL of DH10Bac competent cells, heat shock in 42°C water bath for 90 s after 30 min on ice. After the heat shock, the product was quickly cooled on ice for 3 minutes, then added to 900 mL LB medium that had been incubated at 37°C, and revived at 37°C with shaking at 220 rpm for 1 hour. Take 100 μL of recovered bacterial solution and spread it on the LB solid plate containing 50 μg / mL kanamycin, 7 μg / mL gentamycin, 10 μg / mL tetracycline, 100 μg / mL X-gal and 40 μg / mL IPTG at 37 Cultivate in an upside-down incubator. After 48 hours, a single white colony was picked from the LB solid plate and added to LB liquid medium containing 50 μg / mL kanamycin, 7 μg / mL gentamicin, and 10 μg / mL tetracycline for overnight expansion. After extracting Bacmid genomic DNA, PCR verification was performed using M13 univ...
PUM
| Property | Measurement | Unit |
|---|---|---|
| concentration | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
