Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Pig IFNalpha1-Fc fusion protein as well as encoding gene and expression method thereof

A fusion protein, 1-fc technology, applied in the fields of genetic engineering and bioengineering, can solve the problems of complex renaturation process of inclusion bodies, inactivity, low protein specific activity, etc., to increase the overall immune regulation effect, reduce production costs, High bioactive effect

Active Publication Date: 2013-09-25
江苏晶红生物医药科技股份有限公司
View PDF4 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The former method uses animal cells as raw materials, the production process is complicated, the production cost is high, and the product has the risk of carrying exogenous viruses and other pathogenic microorganisms
In contrast, the E. coli heterologous expression method has the advantages of large yield, high purity, suitable for large-scale production, and easy control of product quality, but its production process is relatively cumbersome
Moreover, due to the lack of protein post-translational processing system in the E. coli system, the expression products are mostly produced in the form of inactive inclusion bodies
However, the renaturation process of inclusion bodies is complex and the renaturation rate is low, resulting in low protein specific activity.
In addition, the purity of the product of the E. coli expression system is not high, and it contains other miscellaneous proteins, so it is difficult to separate and purify

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pig IFNalpha1-Fc fusion protein as well as encoding gene and expression method thereof
  • Pig IFNalpha1-Fc fusion protein as well as encoding gene and expression method thereof
  • Pig IFNalpha1-Fc fusion protein as well as encoding gene and expression method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Example 1, cDNA gene design of porcine IFNα1-Fc fusion protein

[0044] According to the cDNA sequence of Sus scrofa interferon alpha1 published by GenBank (GenBank sequence accession number: EU364896.1), an Fc tag is added before the stop codon at the 3' end of the sequence, and the gene of the Fc fragment is composed of Sus scrofaIgG heavy chain ( GenBank accession number: NM_213828.1) consists of the cDNA sequences of the hinge region, CH2 region and CH3 region, and the obtained sequence is recorded as the original gene sequence of porcine IFNɑ1-Fc. According to the characteristics of the silkworm expression system, the gene sequence was optimized as a whole, and the optimized gene sequence was recorded as the first optimized gene sequence of porcine IFNɑ1-Fc, as shown in SEQ ID NO:1.

[0045] The optimized first optimized gene sequence of porcine IFNɑ1-Fc is more suitable for the silkworm expression system, which is mainly reflected in the following aspects:

[0...

Embodiment 2

[0055] Example 2. Construction of recombinant transfer vector pFastBac-(IFNɑ1-Fc)

[0056] 1. PCR amplification of the second optimized gene product of porcine IFNɑ1-Fc

[0057] Using the artificially synthesized pVL1393-(IFNɑ1-Fc) plasmid as a template, PCR amplification was performed to remove the 23 amino acid signal peptides carried by IFNɑ1 itself, and the system gp64 signal peptide suitable for the insect expression system was added. The obtained gene sequence was marked as porcine IFNɑ1- The second optimized Fc gene, the gene sequence is shown in SEQ ID NO:2. details as follows:

[0058] Use primers as follows:

[0059] Forward primer 1: 5'-

[0060] CGC GGATCC ATGGTAAGCGCTATTGTTTTATATGTGCTTTTGGCGGCGGCGGCGCATTCTGCCTTTGCGTGTGACCTGCCTCAGACCCA-3',

[0061] Reverse primer 1: 5'-CCC AAGCTT TCATTTTTCCTTGGGTCTTGC-3'.

[0062] The upstream primer contains a BamH I restriction site and the gp64 signal peptide sequence, and the downstream primer contains a Hind III res...

Embodiment 3

[0074] Example 3, Construction of Baculovirus BmN-(IFNɑ1-Fc)

[0075] 1. Construction of transfer plasmid Bacmid-(IFNɑ1-Fc)

[0076] Add 5 μL of pFastBac-(IFNɑ1-Fc) plasmid to 100 μL of DH10Bac competent cells, heat shock in 42°C water bath for 90 s after 30 min on ice. After the heat shock, the product was quickly cooled on ice for 3 minutes, then added to 900 mL LB medium that had been incubated at 37°C, and revived at 37°C with shaking at 220 rpm for 1 hour. Take 100 μL of recovered bacterial solution and spread it on the LB solid plate containing 50 μg / mL kanamycin, 7 μg / mL gentamycin, 10 μg / mL tetracycline, 100 μg / mL X-gal and 40 μg / mL IPTG at 37 Cultivate in an upside-down incubator. After 48 hours, a single white colony was picked from the LB solid plate and added to LB liquid medium containing 50 μg / mL kanamycin, 7 μg / mL gentamicin, and 10 μg / mL tetracycline for overnight expansion. After extracting Bacmid genomic DNA, PCR verification was performed using M13 univ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
Login to View More

Abstract

The invention provides a pig IFNalpha1-Fc encoding gene optimized according to a silkworm reaction system, a fusion protein expressed by the pig IFNalpha1-Fc encoding gene and a method for expressing pig IFNalpha1-Fc fusion protein by utilizing a silkworm bioreactor and belongs to the field of biologic gene engineering. As a non-specific broad spectrum antiviral biological agent, a pig interferon alpha 1 has a wide medical prospect, and but being similar to most gene engineering veterinary medicines, the pig interferon alpha 1 has the problems of underproduction, expensive price, irregular quality and short action time. According to the Pig IFNalpha1-Fc fusion protein, a silkworm expression system is used for expressing an optimized pig IFNalpha1-Fc fusion gene to obtain a target protein with relatively high expression efficiency and relatively strong activity. Besides, according to the pig IFNalpha1-Fc fusion protein provided by the invention, the action time of the pig interferon alpha 1 is prolonged, the integral immune adjustment effect is enhanced, and the later-period purification is facilitated, so that the mass production of pig IFNalpha1-Fc fusion protein preparations is realized by utilizing a gene engineering method, and conditions for developing novel feeds containing the fusion proteins are created.

Description

technical field [0001] The invention relates to genetic engineering and bioengineering technology, in particular to a porcine IFNɑ1-Fc fusion protein and its encoding gene and a method for expressing the porcine IFNɑ1-Fc fusion protein by using a silkworm bioreactor. Background technique [0002] Interferon (Interferon, IFN) is a group of active proteins (mainly glycoproteins) with multiple functions, and is a cytokine produced by monocytes and lymphocytes. They have broad-spectrum anti-virus, affect cell growth, differentiation, regulation of immune function and other biological activities on the same kind of cells. According to the source of IFN, that is, animal species, cell type, the nature of the inducer and the induction conditions, it can be divided into three types: α, β, and γ. Among them, IFN-α has the strongest antiviral activity, and also has antitumor, antibacterial, antiprotozoal, and autoimmune disease effects, so it is widely used in various diseases such as...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/63C12N7/01C12N15/866A61K38/21A23K1/16
Inventor 马永钱林徐春林陈晨王耀方
Owner 江苏晶红生物医药科技股份有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com