Aspergillus niger strain producing alpha-amylase, and its application

A technology of amylase and Aspergillus niger, which is applied in the field of microbial mutagenesis screening, can solve the problems of restricting the wide application of amylase and the low expression level of production strains, and achieve the effects of improving taste, improving baking quality and large volume

Active Publication Date: 2014-08-27
QINGDAO VLAND BIOTECH GRP
View PDF5 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, a large number of α‐amylases from Aspergillus (Aspergillus.sp) have been reported and used in industrial production. These amylases have excellent en

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Aspergillus niger strain producing alpha-amylase, and its application
  • Aspergillus niger strain producing alpha-amylase, and its application
  • Aspergillus niger strain producing alpha-amylase, and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0068] Example 1: Cloning of the α-amylase gene AclaP11

[0069] Genomic DNA was extracted from overnight cultures of Aspergillus clavus CGMCC3.5289 using the Fungal Genomic DNA Extraction Kit (Omega) following the manufacturer's instructions.

[0070] Design PCR primers according to the sequence of the α-amylase gene whose numbering is XM_001271888 on NCBI, and the sequence of the forward primer AclaP11-F for cloning the AclaP11 gene in Aspergillus clavus is as follows:

[0071] 5'-ACGGC CTTAAG AAGATGCCTCGGATTTGGTCCTC

[0072] (the sequence shown in the underline is AflII restriction site),

[0073] The reverse primer AclaP11-R sequence is:

[0074] 5'-ATT GCGGCCGC AGCTCAAAGCACAGATCTTGCTTC

[0075] (The underlined sequence is the NotI restriction site).

[0076] The gene was amplified from A. claviculare genomic DNA using Phusion DNA polymerase (Thermo scientific).

[0077] Amplification conditions:

[0078] Step 1: Keep at 98°C for 3 minutes.

[0079] The second s...

Embodiment 2

[0083] Embodiment 2: PEG-mediated protoplast fusion transforms Aspergillus niger

[0084] Draw the Aspergillus niger G1 spore suspension in the center of the CMA plate (9cm petri dish), wait for the colony to cover the whole petri dish, cut 1 / 4 size of the culture based on 200mL CMA liquid medium, culture at 30°C, 200rpm for 14~ 16h.

[0085] Collect the mycelium with a sterile Miracloth filter cloth, and wash it once with solution A, transfer the washed mycelium to 40mL protoplastization solution under aseptic conditions, and incubate at 30°C and 200rpm for 1-2h, The progress of protoplastization was detected by microscopic observation.

[0086] Filter the above-mentioned warm bath liquid with a sterile Miracloth filter cloth, and the obtained filtrate is the protoplast solution. The protoplast solution was divided into two 50mL sterile disposable centrifuge tubes, and the volume of each tube was adjusted to 45mL with solution B, centrifuged at 4000rpm for 8min to obtain th...

Embodiment 3

[0099] Embodiment 3 starts the ultraviolet mutagenesis and screening of bacterial strain Aspergillus niger AclaP11

[0100] CMA plate: 20g glucose, 20g malt extract, 1g peptone, 15g agar, add dlH2O to a final volume of 1000mL, autoclaved.

[0101] Aspergillus niger AclaP11 was used as the starting strain for ultraviolet mutagenesis and screening.

[0102] UV mutagenesis method:

[0103] 1. Preparation of spore suspension: Inoculate Aspergillus niger AclaP11 into slanted CMA medium and culture at 30°C for 5 days. Add 10 mL of sterile normal saline, wash the spores, filter them through a funnel with absorbent cotton, place them in a sterilized Erlenmeyer flask filled with glass beads, oscillate evenly to make a single spore suspension, and count them with a blood cell under an optical microscope After counting, the spore suspension was diluted to 10 with sterile saline 6 Each / mL is the spore suspension to be mutagenized;

[0104] 2. Preheat the UV lamp for 30 minutes; pour 1...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides an alpha-amylase. The amino acid sequence of the alpha-amylase is SEQ ID NO:1. The invention also provides Aspergillus niger P11-51 expressing the alpha-amylase. The strain number of the Aspergillus niger P11-51 is CCTCC NO:M2014017. The mutated strain Aspergillus niger P11-51 obtained through ultraviolet mutagenesis can efficiently express alpha-amylase from Aspergillus clavatus, and the fermenting enzyme activity of the Aspergillus niger P11-51 is 486.65CU/mL, and is 1.99 times that of an original strain. The Aspergillus niger P11-51 is a food safety bacterium (GRAS), and alpha-amylase produced by the Aspergillus niger P11-51 can be widely applied in the food processing field. The alpha-amylase can increase the specific volume of bread by 10-15%, reduces the hardness of bread crust and bread crumb, improves the quality of bread, improves the baking quality of the bread, improves the size of the volume, improves the mouthfeel of the bread, and makes particles soft.

Description

technical field [0001] The invention belongs to the technical field of microbial mutagenesis screening, and in particular relates to an alpha-amylase-producing Aspergillus niger mutagenic strain and application thereof. Background technique [0002] α-amylase (α-amylase) is an endonuclease, which acts on starch by randomly cutting α-1,4 glycosidic bonds inside the starch molecule, so that the starch molecule degrades rapidly, loses its viscosity, and at the same time hydrolyzes The reducing power of the substance increases. [0003] Amylase is a biocatalyst with a wide range of uses, and α-amylase is one of the important enzyme preparations discovered earlier and used in industry. α-amylase is widely used in the starch processing industry, such as the manufacture of glucose, maltose, various dextrins, etc.; in the food industry, such as bread baking, maltose, monosodium glutamate, fruit juice, spices and other industries; in the brewing and fermentation industry, such as be...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N9/30C12N15/56C12N15/80C12N1/15C12R1/685
CPCA21D8/042C12N9/242C12Y302/01001
Inventor 王华明林艳梅
Owner QINGDAO VLAND BIOTECH GRP
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap