A kind of Aspergillus niger strain producing α-amylase and application thereof
A technology of Aspergillus niger and strains, applied in the field of microbial mutagenesis screening, which can solve the problems of restricting the wide application of amylase and low expression of production strains, and achieve the effects of improving taste, baking quality and soft granules
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0068] Example 1: Cloning of the α-amylase gene AclaP11
[0069] Genomic DNA was extracted from overnight cultures of Aspergillus clavus CGMCC3.5289 using the Fungal Genomic DNA Extraction Kit (Omega) following the manufacturer's instructions.
[0070] Design PCR primers according to the sequence of the α-amylase gene whose numbering is XM_001271888 on NCBI, and the sequence of the forward primer AclaP11-F for cloning the AclaP11 gene in Aspergillus clavus is as follows:
[0071] 5'-ACGGC CTTAAG AAGATGCCTCGGATTTGGTCCTC
[0072] (the sequence shown in the underline is AflII restriction site),
[0073] The reverse primer AclaP11-R sequence is:
[0074] 5'-ATT GCGGCCGC AGCTCAAAGCACAGATCTTGCTTC
[0075] (The underlined sequence is the NotI restriction site).
[0076] The gene was amplified from A. clavus genomic DNA using Phusion DNA polymerase (Thermoscientific).
[0077] Amplification conditions:
[0078] Step 1: Keep at 98°C for 3 minutes.
[0079] The second step: h...
Embodiment 2
[0083] Embodiment 2: PEG-mediated protoplast fusion transforms Aspergillus niger
[0084] Take the Aspergillus niger G1 spore suspension in the center of the CMA plate (9cm petri dish), wait for the colony to cover the whole petri dish, cut 1 / 4 size of the culture based on 200mL CMA liquid medium, culture at 30°C, 200rpm for 14-16h .
[0085] Collect the mycelium with a sterile Miracloth filter cloth, and wash it once with solution A, transfer the washed mycelium to 40mL protoplastization solution under aseptic conditions, and incubate at 30°C and 200rpm for 1-2h, The progress of protoplastization was detected by microscopic observation.
[0086] Filter the above-mentioned warm bath liquid with a sterile Miracloth filter cloth, and the obtained filtrate is the protoplast solution. The protoplast solution was divided into two 50mL sterile disposable centrifuge tubes, and the volume of each tube was adjusted to 45mL with solution B, centrifuged at 4000rpm for 8min to obtain th...
Embodiment 3
[0099] Embodiment 3 starts the ultraviolet mutagenesis and screening of bacterial strain Aspergillus niger AclaP11
[0100] CMA plate: 20g glucose, 20g malt extract, 1g peptone, 15g agar, add dlH2O to a final volume of 1000mL, autoclaved.
[0101] Aspergillus niger AclaP11 was used as the starting strain for ultraviolet mutagenesis and screening.
[0102] UV mutagenesis method:
[0103] 1. Preparation of spore suspension: Inoculate Aspergillus niger AclaP11 into slanted CMA medium and culture at 30°C for 5 days. Add 10 mL of sterile normal saline, wash the spores, filter them through a funnel with absorbent cotton, place them in a sterilized Erlenmeyer flask filled with glass beads, oscillate evenly to make a single spore suspension, and count them with a blood cell under an optical microscope After counting, the spore suspension was diluted to 10 with sterile saline 6 Each / mL is the spore suspension to be mutagenized;
[0104] 2. Preheat the UV lamp for 30 minutes; pour 1...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
