Recombined lipoxygenase and preparation method thereof

An oxygenase and recombinant lipid technology, applied in the field of bioengineering, can solve the problems of many types of enzymes, difficult to control, unstable enzyme activity, etc., and achieve the effects of high enzyme purity, low degree of evolution, and stable enzyme activity.

Inactive Publication Date: 2015-01-21
NINGBO UNIV
View PDF4 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In the prior art, lipoxygenases are all monofunctional enzymes, which only catalyze the hydroperoxidation reaction of fatty acids. To form short-chain spices, HPL must be required to continue to decompose their products, and the reaction conditions of the two enzyme systems are complicated. , is more difficult to control and is not suitable for large-scale production, and the reaction enzymes used in the general enzymatic synthesis of short-chain spices are crude enzyme liquids extracted from plants, such as Chinese patents CN1563310A and CN101225406A, the enzyme types in this crude enzyme liquid Many, unstable enzyme activity, resulting in unstable products, not suitable for production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombined lipoxygenase and preparation method thereof
  • Recombined lipoxygenase and preparation method thereof
  • Recombined lipoxygenase and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] Embodiment 1: Cloning of PhLOX full-length cDNA sequence

[0019] Extract the genomic DNA of Porphyra thallus with the CTAB method (cetyltrimethylammonium bromide method), and the steps are as follows:

[0020] 1) After preheating 2% CTAB extract in a water bath at 65°C, dispense 15mL of the extract into 50mL centrifuge tubes, add 0.1% mercaptoethanol, mix well and set aside;

[0021] 2) Take 500mg of fronds, quickly grind them into powder with liquid nitrogen in a sterile mortar, and immediately transfer them to CTAB extract;

[0022] 3) After oscillating evenly, heat in a 65°C water bath for 60 minutes, during which time the centrifuge tubes are repeatedly inverted several times every 10 minutes;

[0023] 4) Put it into a centrifuge for centrifugation, the centrifugation conditions are: 4°C, 8000rpm, 10min, after the centrifugation, suck the supernatant;

[0024] 5) Add an equal volume of phenol / chloroform / isoamyl alcohol mixture (ratio: 25 / 24 / 1) to the above supern...

Embodiment 2

[0047] Example 2: Construction of recombinant system for PhLOX prokaryotic expression

[0048] Design a pair of specific primers with NdeI / HindIIII restriction sites at both ends of the ORF (open reading frame) of PhLOX: Forward primer: 5'GGAATTCCATATGATGGGGAATGCG3'

[0049] Reverse primer: 5'CCCAAGCTTCTAGATGTCGATGGACAG3'.

[0050]The PhLOX complete ORF was amplified using the total thallus cDNA as a template. The cloned target fragment was first connected to pMD-18T (Takara, Japan) to form a LOX-18T recombinant cloning vector, and sequenced by transforming E.coli DH5α to check the correctness of the coding of the target fragment. Select pET-28a (Takara, Japan) as the expression vector, and in each 40 μL system, take the LOX-18T and pET-28a empty vectors and use 2U of NdeΙ / HindΙΙΙ (BioLabs, UK) for double enzyme digestion, and incubate at 37°C for 2h above. Take 5 μL of the digested product and perform 1.5% agarose gel electrophoresis for detection. After the plasmid is dig...

Embodiment 3

[0051] Example 3: Induction and purification of PhLOX protein

[0052] The cloning strain obtained in Example 2 was activated, expanded, and expressed with 0.1 mM IPTG. The induction conditions are 20°C, 100rpm, 14-20h. After the induction was completed, the bacterial cells were collected by centrifugation at 5000 rpm, 4°C, and 15 min. Remove the supernatant culture solution, and then fully resuspend the cells with 10mL cell lysate buffer A-II (50mM Tris-HCl, pH8.0, 200mM NaCl, 10% (v / v) glycerol, 0.1% tween20). The cells were crushed and homogenized (Bertin technologies Precellys24Dual, France) at 6500rpm, 20s-breaking / 2min-ice-bath program, with 4 cycles. The homogenate was centrifuged at 12000 rpm at 4°C for 10 min, and the supernatant was collected.

[0053] The target protein was purified from the supernatant using 6×His-Tagged Protein Purification Kit (CWBIO, China), and the target protein was collected by gradient elution with eluents containing 10mM, 50mM, 150mM, an...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a recombined lipoxygenase PhLOX and a preparation method thereof. The PhLOX has activities of a lipoxygenase, a hydroperoxide lyase and a propadiene oxide synthetase at the same time. The method includes following steps: extracting total RNA from porphyra haitanensis; designing a primer according to a gene sequence of the lipoxygenase; amplifying an overall-length cDNA sequence through an RACE technology; recombining the overall-length cDNA sequence to an expression vector pET-28a; converting escherichia coli E.coli BL21; screening out positive clone; and generating the multifunctional lipoxygenase of a bacteria liquid with an expression quantity being 2mg / L through inducible expression. Compared with a lipoxygenase in the prior art, the recombined lipoxygenase has a plurality of enzyme functions, is free of a strict substrate specifity and allows downstream products in various structures to be formed.

Description

technical field [0001] The invention relates to the technical field of bioengineering, in particular to a recombinant lipoxygenase and a preparation method thereof. Background technique [0002] Lipoxygenase (LOX) is a dioxygenase containing non-heme ions, widely present in aerobic organisms, including plants, animals and lower aquatic organisms, and can catalyze (Z,Z)-1,4 The oxygenation reaction of the unsaturated fatty acid of the pentadiene structural unit produces the peroxide of the unsaturated fatty acid, participates in various physiological functions such as plant germination, growth, development, aging, plant resistance to disease and injury, and involves in animals Inflammation. [0003] The product of LOX—hydroperoxidized fatty acid, under the action of other enzymes, finally generates jasmonic acid, leukotrienes and short-chain aromatic compounds. The short-chain aromatic compounds are widely used in food, daily chemical and pharmaceutical industries, such as ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/53C12N9/02C12N15/70
Inventor陈海敏朱竹君陈娟娟严小军
OwnerNINGBO UNIV