Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Threonine dehydratase and application thereof

A threonine dehydratase and amino acid technology, applied in the biological field, can solve the problems of weak nanoparticle size control, large environmental damage, complicated operation, etc., achieve high fluorescence intensity and fluorescence stability, environmental friendliness, and simple and easy raw materials The effect

Active Publication Date: 2019-04-05
INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The current method has the disadvantages of high energy consumption, great environmental damage, and complicated operation. The preparation of metal sulfide nanoparticles by biosynthesis has the advantages of low energy consumption, environmental friendliness, and easy operation.
The preparation methods of introducing biological factors in previous reports are mostly limited to Na 2 In the synthesis process of precursors such as S, biomolecules are used to control the structure of nanoparticles [3-6], the operation is more complicated, and the ability to control the size of nanoparticles is weak

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Threonine dehydratase and application thereof
  • Threonine dehydratase and application thereof
  • Threonine dehydratase and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] The separation and purification of embodiment 1 threonine dehydratase

[0041] The genome of Pseudomonas stutzeri 273 was known from Genbank, and the accession number of Genbank was CP015641, so as to obtain the complete sequence as a template, PCR amplification was carried out according to the following primers to obtain the threonine dehydration shown in SEQ ID NO.1 The gene encoding the enzyme, the amplified gene was connected to the expression plasmid pET28a by HindIII / BamHI double enzyme digestion and ligation method, and then the threonine dehydratase expression plasmid (pET28a-TD) was obtained, and then the ligation product was transformed into the large intestine Overexpression in E.coli BL21;

[0042] Amplification primers are F: CGCGGATCCGCGATGTTCGATCTACACCAACT; R: CCCAAGCTTGGGTCAGGCGGTCTGGCCAGCCG;

[0043] The PCR system is: 1 microliter of template, 1 microliter of primer F1, 1 microliter of primer R1, 17 microliters of water, and 20 microliters of high-fid...

Embodiment 2

[0067] Embodiment 2 Threonine dehydratase catalyzes generation of hydrogen sulfide (H 2 S) enzyme activity detection

[0068] The separated and purified threonine dehydratase was subjected to SDS-PAGE electrophoresis, and a single band was observed after Coomassie brilliant blue staining ( figure 1 B), by figure 1 B shows that the obtained threonine dehydratase is single and the concentration is relatively high.

[0069] The isolated and purified threonine dehydratase was subjected to Native-PAGE electrophoresis, and brown bands were observed after bismuth chloride staining ( figure 1 A), threonine dehydratase catalyzes the production of H 2 S with bismuth chloride produces bismuth sulfide precipitates that are observed as brown bands.

[0070] Among them, the bismuth chloride staining buffer is triethanolamine hydrochloride 100mmol / L, pyridoxal phosphate 10μmol / L, bismuth chloride 1.0mmol / L, EDTA10mmol / L, L-cysteine ​​20mmol / L, pH 7.6.

Embodiment 3

[0071] Example 3 Utilize threonine dehydratase to prepare cadmium sulfide nanoparticles with cysteine ​​as a coating material. 0.5mmol / L CdCl 2 and 20mmol / L cysteine ​​were added to Tris buffer (Tris 50mmol / L, NaCl 150mmol / L, pH 7.5) containing 0.1mg / ml threonine dehydratase. The cadmium sulfide nanoparticle solution can be prepared by placing the enzymatic solution at 37° C. for 20-220 minutes.

[0072] It can be seen from the above system that the content of cysteine ​​both as a substrate and as a coating should be much higher than that of cadmium. The higher the amount of cysteine, the better the stability of the cadmium sulfide nanoparticle system.

[0073] The prepared cadmium sulfide nanoparticle solution is carried out to the detection of absorption spectrum and fluorescence spectrum, the result shows that it has specific absorption peak and fluorescence peak, and it has significant fluorescence generation characteristics under ultraviolet light irradiation ( figure 2...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biology and in particular relates to threonine dehydratase and application thereof. A coding gene sequence is obtained from pseudomonas stutzeri 273 andshown as SEQ ID NO. 1. The threonine dehydratase has a capability of catalyzing cysteine in vitro to generate hydrogen sulfide; meanwhile, the threonine dehydratase also has a capability of catalyzing the cysteine and cadmium chloride through a single-enzyme system to generate cadmium sulfide nanoparticles. The nanoparticles obtained by the invention have relatively good water solubility and relatively high fluorescence intensity and fluorescence stability, and can be used as a novel fluorescent probe to be applied in the fields including photoelectric sensors, biosensors, biomedicines and the like.

Description

technical field [0001] The invention belongs to the field of biotechnology, in particular to a threonine dehydratase and its application. Background technique [0002] Nanostructured particles exhibit excellent properties in electricity, optics, magnetism, and mechanics. Among them, metal sulfide nanoparticles have attracted extensive attention in recent years due to their potential applications in electronics, optics, optoelectronic devices, and biomedicine [1]. The existing preparation methods of metal sulfide nanoparticles are mostly chemical and physical methods, such as liquid phase chemical reaction, hydrothermal growth method, high pressure treatment method, physical vapor deposition method, chemical vapor deposition method, etc. [2]. The current method has the disadvantages of high energy consumption, great environmental damage, and complicated operation. The preparation of metal sulfide nanoparticles by biosynthesis has the advantages of low energy consumption, env...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/88C12N15/70B82Y40/00C09K11/56B82Y20/00G01N21/31G01N21/64C12P3/00
CPCG01N21/314G01N21/6486C09K11/565C12N9/88C12N15/70C12P3/00B82Y20/00B82Y40/00G01N2021/3148
Inventor 孙超岷马宁
Owner INST OF OCEANOLOGY - CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com