Glucosidase/xylosidase difunctional cellulose degradation enzyme RuGBGX2 as well as coding gene and application thereof

A technology of glucosidase and xylosidase, applied in the field of glucosidase/xylosidase dual-functional cellulose degrading enzyme and its preparation, can solve the problem of weak natural cellulose hydrolysis ability, low activity of insoluble cellulose, and cellulose production Bioenergy and other issues, to achieve the effect of large industrial prospects and value, broad industrial application prospects, and reduce production costs

Active Publication Date: 2011-05-04
FUDAN UNIV +1
View PDF2 Cites 17 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among them, cellulase derived from bacteria generally has an optimum pH of neutral to slightly alkaline, and has a weak hydrolysis ability to natural cellulose. It is mainly used in washing finishing and washing industries in textiles, but it is difficult to be used in biofuels. production; cellulase derived from fungi generally hydrolyzes cellulose substrates under acidic or neutral to slightly acidic conditions, and is mainly used in the feed industry. However, cellulase derived from fungi must form an enzyme system to play a better role. The components of the enzyme system are often very complex, and the enzyme activity of a single component is low, thus limiting its application in bioenergy
Moreover, these cellulase enzymes are mainly for soluble and pure cellulose with high hydrolysis ability, and have very low or even no activity for insoluble cellulose, and are helpless for insoluble cellulose mixed with anti-nutritional factors. Therefore, the cloning of new cellulase with high activity has great scientific and industrial significance

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Glucosidase/xylosidase difunctional cellulose degradation enzyme RuGBGX2 as well as coding gene and application thereof
  • Glucosidase/xylosidase difunctional cellulose degradation enzyme RuGBGX2 as well as coding gene and application thereof
  • Glucosidase/xylosidase difunctional cellulose degradation enzyme RuGBGX2 as well as coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1 The construction of Chinese yak rumen microbial metagenomic DNA library

[0042] The rumen contents of 2 Chinese Qinghai yaks were collected from a slaughterhouse in Xining City, filtered through three layers of gauze, the filtrate was centrifuged to collect rumen microbial cells, and frozen at -80°C until use. Take 100-200ul bacterial sample, wash 2-3 times with 1ml PBS, add 650uL DNA extraction buffer (Tris-HCl, 100mMpH8.0; Na 2 EDTA 100mM pH8.0; Na 3 PO 4 Buffer 100mM pH8.0; NaCl 1.5M; CTAB 1%; pH8.0), mix well, place in -80℃, then place in 65℃ water bath to melt, repeat three times; add 3-4μL lysozyme after cooling ( 100mg / L) shake horizontally (37°C, 225rpm) in a shaker for about 30min; add 2-3μL proteinase K (20mg / mL) and continue shaking for about 30min; add 50-70uL SDS (20%), mix well, Incubate at 65°C for 1-2h, invert the centrifuge tube up and down every 10-20min to mix; centrifuge at 12,000rpm for 10min at room temperature, collect the supernatan...

Embodiment 2

[0045] Example 2 Cloning and sequence analysis of RuBGX2 gene derived from rumen microorganisms

[0046] The 16C12 glucosidase / xylosidase gene was cloned into the pGEM11z vector by subcloning: the cosmid plasmid of the screened positive clone 16C12 was cut into 2-5kb fragments with the Sau3A I part, and then ligated into the pGEM11z vector which was digested with BamHI and Transform DH5a into the dephosphorylated pGEM11z vector, and perform functional screening on the subcloned library by the method described in Example 1. The obtained subclones were sequenced with T7 and SP6 universal primers, and the β-1, 4 - the coding region sequence of the glucosidase gene, its gene nucleotide sequence is as shown in SEQ ID NO 1, and is named as RuBGX2.

[0047] The RuBGX2 gene cds encodes 755 amino acids, the ORF sequence is shown in SEQ ID NO 2, and the theoretical molecular weight is 82.4kD. Using SMART to analyze the structural domain, it shows that the 18 amino acids from the N-term...

Embodiment 3

[0048] Recombinant expression of embodiment 3 RuBGX2 gene in escherichia coli

[0049] In order to clone the cds sequence of RuBGX2 gene into Escherichia coli expression vector pET-21a for recombinant expression, a pair of primers were designed: the forward primer sequence is RuBGX2F:AAT GAATTC ATGAAAGCAATCCTTACAACC, reverse primer is RuBGX2R:TAT AAGCTTTAGCGTCACAGTCACGTTC, the underlined restriction enzyme sequence. The RuBGX2 gene fragment was amplified by PCR reaction. After gel recovery, it was digested with EcoR I and HindIII. After the fragment was recovered, it was ligated with the pET-21a vector that was also digested with EcoR I and HindIII. The ligated product was transformed into E. coli Top10 Bacterial strains, the obtained transformants were identified by cooking PCR using the above primers, and the transformants containing 2.3kb amplified fragments were detected for enzyme activity and sequenced for identification, and the correct transformants were named Top10...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a novel beta glucosidase / xylosidase difunctional cellulose degradation enzyme RuGBGX2 as well as a coding gene and application thereof. The coding sequence of amino acid of the RuGBGX2 contains 18-755th sites of an SEQ ID NO 2 sequence. The RuGBGX2 is sourced from the rumen microorganism of yak from China, a novel coding gene of the beta glucosidase / xylosidase difunctional cellulose degradation enzyme RuGBGX2 is obtained by function screening and sequencing analysis on a rumen metagenome cosmid library and a subclone library. The beta glucosidase / xylosidase difunctional cellulose degradation enzyme provided by the invention can be widely applied to the degradation of cellulose and the fields such as cellulose biotransformation, chemical industry, spinning, foods, bioenergy, feed additives, medical industry and the like. By utilizing the difunctional enzyme RuGBGX2 to degrade wood fiber, the varieties of added enzymes can be reduced, and an enzymolysis process can be simplified.

Description

technical field [0001] The invention belongs to the field of bioengineering, and relates to a glucosidase / xylosidase bifunctional cellulose degrading enzyme, a preparation method and application thereof. The invention also provides the recombinant plasmid and recombinant genetic engineering strain of the glucosidase / xylosidase. Background technique [0002] Lignocellulose is the most widely distributed and abundant renewable carbohydrate on earth, mainly composed of cellulose, hemicellulose and lignin. Among them, the hydrolysis of cellulose requires the joint action of three cellulase enzymes, endoglucanase, exoglucanase (also known as cellobiohydrolase) and β-glucosidase; and hemicellulose The hydrolysis of β-1,4-xylanase and β-1,4-xylosidase requires the joint action of these two enzymes. [0003] Glucosidase and xylosidase mainly hydrolyze cellooligosaccharides (mainly cellobiose) and xylooligosaccharides in the degradation of cellulose and hemicellulose main chains, a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/42C12N15/56C12N15/63C12P19/14C12R1/645C12R1/01C12R1/685C12R1/125C12R1/84C12R1/865C12R1/19
Inventor吕红包蕾周峻岗袁汉英詹志春
OwnerFUDAN UNIV