A high-salt-resistant colorimetric sensor based on zinc-based functional nucleic acid and its application

A technology of colorimetric sensors and functional nucleic acids, applied in instruments, scientific instruments, genetic engineering, etc., can solve the problems of poor selectivity, high price, and low sensitivity, and achieve the effects of low cost, high sensitivity, high specificity, and sensitivity

Active Publication Date: 2020-10-02
CHINA AGRI UNIV
View PDF11 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Traditional zinc detection methods can generally be divided into cold atomic absorption spectrometry, graphite carbon atomic absorption spectrometry and flame atomic absorption spectrometry, etc., but generally have the characteristics of low sensitivity, poor selectivity, susceptible to interference, and expensive

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A high-salt-resistant colorimetric sensor based on zinc-based functional nucleic acid and its application
  • A high-salt-resistant colorimetric sensor based on zinc-based functional nucleic acid and its application
  • A high-salt-resistant colorimetric sensor based on zinc-based functional nucleic acid and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] Example 1: Construction of a high-salt-resistant colorimetric sensor based on zinc-based functional nucleic acids

[0055] 1. Experimental materials

[0056] Potassium Chloride, Sodium Chloride, Magnesium Chloride, Potassium Hydrogen Phosphate, Disodium EDTA, Thioflavin, Zinc Chloride, Urea, Nt.BstNBI Nicking Endonuclease, Bst DNA Polymerase, 4-Hydroxy Ethylpiperazineethanesulfonic Acid (HEPES), Sodium Hydroxide, Disodium Hydrogen Phosphate.

[0057] 2. Sequence design

[0058] Design and synthesize DNAzyme substrate strands, DNAzyme enzyme strands, and amplification templates. In the amplification template, GACTC is the Nt.BstNBI nicking endonuclease recognition sequence, and the first four base pairs of the sequence (between C and A) are the synthetic chain cleavage sites; the zinc ion cleavage site is at the base of the deoxyribozyme After A in the chain of things A.

[0059]

[0060] 3. Construction method

[0061] The construction method of the high-salt re...

Embodiment 2

[0078] Embodiment 2: the detection of zinc ion

[0079] The zinc ion solution to be measured is a zinc chloride solution (NaCl is a dissolution environment), and the specific steps are as follows:

[0080] (1) Prepare the standard curve of fluorescence intensity changing with zinc ion concentration

[0081] Using the construction method of 3 in Example 1, the zinc ion solution to be tested is selected as zinc chloride solution (1M NaCl is the dissolution environment), the zinc ion concentration is 25pM, 50pM, 75pM, 100pM and 125pM, and the excitation wavelength is set at 425nm to prepare Standard curve of fluorescence intensity (FL) varying with zinc ion concentration at a wavelength of 485nm ( image 3 ), the standard curve is y=106.22x+893.33, R 2 = 0.9941.

[0082] (2) Using the construction method of 3 in Example 1, measure the fluorescence intensity of the zinc ion solution to be tested, and bring it into the standard curve y=106.22x+893.33 to obtain the zinc ion conce...

Embodiment 3

[0085] Embodiment 3: A kind of test kit that detects zinc ion

[0086] A kit for detecting zinc ions, comprising a zinc ion deoxyribozyme system, an isothermal amplification system and a display system;

[0087] Zinc ion deoxyribozyme system includes substrate chain, enzyme chain, buffer, zinc ion standard solution and stop solution;

[0088] The isothermal amplification system includes amplification template, dNTPs, ultrapure water, Bst DNA polymerase, polymerase reaction buffer solution, Nt.BstNBI nicking endonuclease and Nt.BstNBI nicking endonuclease reaction buffer solution;

[0089] The display system includes: thioylavin stock solution and display buffer.

[0090] The sequence (5'-3') of the deoxyribozyme substrate chain is: GCTAGAGATTTTCCACACTGATGCAGACGTTGAAGGATTATCTACTAAAAGGGTCTGAGGG;

[0091] The sequence (5'-3') of the deoxyribozyme enzyme chain is: AGATAATCTAGTTGAGCTGTCTGCAT;

[0092] The sequence (5'-3') of the amplification template is: CCCAACCCGCCCTACCCCCCAAC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a high salt tolerant colorimetric sensor based on functional nucleic acid of zinc and application thereof. The high salt tolerant colorimetric sensor includes a molecular recognition element, a signal amplification element, and a signal conversion element. The molecular recognition element consists of zinc ion deoxyribozyme, which is composed of a substrate chain and an enzyme chain. The signal amplification element includes an isothermal amplification system, and the isothermal amplification system also includes an amplification template. The signal conversion elementincludes thioflavin. The molecular recognition element recognizes zinc ions and produces an amplification product, the amplification product forms a G-quadruplex structure under the action of thioflavin, and the fluorescence intensity is detected to calculate the zinc ion concentration. The sensor provided by the invention is based on zinc ion deoxyribozyme, isothermal index amplification reactionand G-quadruplex liquid phase sensing technology, can be used for field detection of zinc ions in the environment, and has the advantages of simple and rapid operation, low cost, high sensitivity andgood selectivity.

Description

technical field [0001] The invention belongs to the technical field of ion detection, and in particular relates to a high-salt-resistant colorimetric sensor based on zinc-based functional nucleic acid and an application thereof. Background technique [0002] Heavy metal zinc (Zinc, Zn) is a widely distributed metal element in nature, mainly exists in the state of zinc sulfide and zinc oxide, and can also coexist with minerals of many elements such as lead, copper, and zinc. Zinc pollution refers to the environmental pollution caused by zinc and its compounds. The main sources of pollution are zinc mining, smelting and processing, machinery manufacturing, galvanizing, instrumentation, organic synthesis, and papermaking industries. Automobile tire wear and dust and smoke produced by coal combustion all contain zinc and its compounds. Zinc in industrial wastewater often exists in the form of zinc hydroxyl complexes. [0003] Zinc is the most abundant trace element in the huma...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/6844
CPCC12N15/113C12N2310/12C12Q1/6825C12Q1/6844G01N21/64G01N21/6402G01N21/6428G01N21/78G01N33/5308G01N33/533G01N33/535G01N2021/6417G01N2021/6441C12Q2521/345
Inventor许文涛罗云波黄昆仑田晶晶肖冰杜再慧董凯
OwnerCHINA AGRI UNIV