Supercharge Your Innovation With Domain-Expert AI Agents!

Application of soybean E2 ubiquitin combined with enzyme gene GmUBC1

A technology of soybeans and coding genes, which is applied in the fields of application, genetic engineering, plant genetic improvement, etc.

Active Publication Date: 2020-01-21
NANJING AGRICULTURAL UNIVERSITY
View PDF16 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although many genes of ubiquitin conjugating enzymes have been identified in many species, there are relatively few reports of ubiquitin E2 conjugating enzyme UBC genes in soybean. Therefore, the function of soybean E2 ubiquitin conjugating enzyme gene still needs further experimental verification

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of soybean E2 ubiquitin combined with enzyme gene GmUBC1
  • Application of soybean E2 ubiquitin combined with enzyme gene GmUBC1
  • Application of soybean E2 ubiquitin combined with enzyme gene GmUBC1

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1 Cloning and identification of soybean GmUBC1 and its coding gene

[0031] Primers were designed according to the sequence information of GmUBC1 predicted on the phytozome website, and the flower cDNA of the cultivated soybean variety “Nannong 94-16” was used as a template for PCR amplification.

[0032] Upstream primer GmUBC1F1: TTTGCTGATTCTCTCGGCGT; (SEQ ID NO.3)

[0033] Downstream primer GmUBC1R1: AGGTAACTGGAAACTGCGAGG. (SEQ ID NO.4)

[0034] The GmUBC1 gene was amplified from the total RNA of soybean floral organs by RT-PCR. Take the soybean flower tissue, grind it with a mortar, add it into a 1.5mL EP tube filled with lysate, shake it fully, and then transfer it into a glass homogenizer. After homogenization, transfer to 1.5mLEP tube, and use plant total RNA extraction kit (TIANGEN DP404) for total RNA extraction. The quality of total RNA was identified by formaldehyde denaturing gel electrophoresis, and then the RNA content was determined on a spectr...

Embodiment 2

[0035] Example 2 Expression characteristics of GmUBC1 in different organs of soybean

[0036] The RNA of roots, stems, leaves, flowers, 7d seeds, 10d seeds, 15d seeds, 30d seeds, 45d seeds of soybean mutants cco and Nannong 94-16 were extracted and reversed into cDNA for RT-PCR analysis.

[0037] The extraction of total RNA was the same as in Example 1. The soybean constitutively expressed gene Tubulin was used as an internal reference gene, and the amplification primers were Tubulin forward primer sequence: GGAGTTCACAGAGGCAGAG (SEQ ID NO.5), and Tubulin reverse primer sequence: CACTTACGCATCACATAGCA (SEQ ID NO.6). Using cDNA from different soybean tissues or organs as templates, real-time fluorescent quantitative PCR analysis was carried out. The amplification primers of GmUBC1 are: GmUBC1F2: GGCGTTGTTCATTTCTGTCTCA (SEQ ID NO.7), GmUBC1R2: TCGAGTTCGATTGCAAAACGT (SEQ ID NO.8). result( figure 1) analysis showed that the expression level of GmUBC1 was higher at different stage...

Embodiment 3

[0038] Example 3 Subcellular localization of GmUBC1

[0039] Subcellular localization adopts the method of onion epidermal cell expression. Using fresh onions, the appropriate inner epidermis is peeled off in the ultra-clean bench the day before the gene gunning, and it is tightly attached to the MS solid medium plate, and cultured overnight in the dark. Set aside for the next day. The open reading frame of the GmUBC1 gene was amplified by using the correctly sequenced carrier connected with the full-length GmUBC1 cDNA as a template, and fused with the GFP reporter gene to form a GmUBC1-GFP chimeric gene. After the plasmid is wrapped with gold powder, it is injected into onion epidermal cells by gene gun method to express, and the onion epidermis bombarded by gene gun can be observed by laser confocal microscope after being cultured in a dark environment at room temperature for one day. The result is as figure 2 As shown, the transformed empty plasmid is distributed in the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of soybean E2 ubiquitin combined with enzyme gene GmUBC1. The soybean GmUBC1 protein coding gene GmUBC1 has a nucleotide sequence of SEQ ID NO.1. The constructedplant overexpression vector pMDC83-GmUBC1 is subjected to heterologous expression in the wild type of Arabidopsis thaliana, and the invention finds that the thousand seed weight of a transgenic plantis remarkably increased, and the total amino acid content is remarkably increased. The invention shows that the gene can be used as a target gene to be introduced into plants, and the fruit quality of the transgenic plant is improved by overexpressing the GmUBC1 gene. As can be seen, the soybean GmUBC1 protein coding gene GmUBC1 can improve the fruit weight and the amino acid content through genetic engineering so as to improve the soybean quality, and has important application value.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering and relates to the application of soybean E2 ubiquitin conjugating enzyme gene GmUBC1. Background technique [0002] Ubiquitin-conjugating enzyme E2 (ubiquitin-conjugating enzyme) is a multi-gene family, involving more than 100 species in animals and humans. This pathway is widely involved in plant hormone signal transduction, and plays an important role in maintaining cell function and cell cycle operation, resisting environmental stress, hormone response, embryonic development and aging. [0003] The plant ubiquitination research is the most in-depth in Arabidopsis, about 1 400 genes (accounting for about 5% of the total protein quantity) encode the components of the protein ubiquitination system (Wang Jinli et al., 2010). Among them, there are 37 E2 genes and 8 E2-like genes (Estelle M et al.2004). The E2 protein consists of a conserved catalytic domain consisting of 150 amino acids, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C07K14/415C12N15/82A01H5/00A01H5/10
CPCC07K14/415C12N15/8261C12N15/8251
Inventor 黄方毛卓卓阚贵珍王慧程浩王娇喻德跃
Owner NANJING AGRICULTURAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com