S.roseus lipid droplet protein 1, coding gene and application thereof

A yeast lipid and protein technology, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problem of increasing the oil content of recombinant strains, and achieve the effect of improving the stability of lipid droplets and increasing the oil content

Active Publication Date: 2014-08-06
DALIAN INST OF CHEM PHYSICS CHINESE ACAD OF SCI
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The researchers found that genes encoding isocitrate dehydrogenase (IDH) and malic enzyme (ME) from oleaginous microorganisms (Rhodosporidium toruloides and Liposporidium steerii) were expressed during oil accumulation in indigenous bacteria cerevisiae functional complementation analysis also proved that these genes can increase the oil content of recombinant strains, but failed to successfully transform a non-oleaginous strain into an oleaginous strain [Yang F, Zhang SF, Zhou YJ, Zhu ZW, Lin XP, Zhao ZK.Appl.Microbiol.Biotechnol.2012, 94(4), 1095-1105]

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • S.roseus lipid droplet protein 1, coding gene and application thereof
  • S.roseus lipid droplet protein 1, coding gene and application thereof
  • S.roseus lipid droplet protein 1, coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0059] Example 1: Discovery of Saccharomyces spp. perilipin-like protein

[0060] S. roseus JCM8242 was cultured in liquid YEPD medium at 30°C for 36h. The wet cells were collected by centrifugation, washed twice with distilled water, and stored in a -80°C refrigerator for RNA and protein extraction. The same cultured samples (parallel samples) were used to determine the dry cell weight and oil content. Sample named 'YEPD'.

[0061] S. roseus JCM8242 was fermented on nitrogen-limited medium to achieve oil accumulation. It is carried out in a FUS-15L bioreactor with a liquid volume of 8L, an inoculum volume of 10%, a temperature of 30°C, an aeration rate of 0.8vvm, and dissolved oxygen controlled at 40-50% saturation value (dissolved oxygen and stirring linkage). The pH was automatically controlled at 5.6 by dropwise addition of 10.0M NaOH and 2M HCl. Take out 50mL of cell culture fluid cultured for 24h and 96h respectively, and the samples are named '24h' and '96h' respect...

Embodiment 2

[0085] Embodiment 2: the cloning of srldp1 gene of sporogenous yeast

[0086] According to the amino acid sequence of SrLDP1, degenerate primers were designed:

[0087] srldp1-sence: ATGGARCARACNTTYCC (N: A / C / G / T, R: A / G, Y: C / T)

[0088] srldp1-anti: TTAYTCNGAYTTNGTCGT (N: A / C / G / T, Y: C / T) ( / stands for "or")

[0089] The primers were all in the 5' to 3' direction.

[0090] S. roseus JCM8242 total RNA was extracted by liquid nitrogen grinding plus RNAiso method [Yang F, Tan HD, Zhou YJ, Lin XP, Zhang SF.Mol.Biotechnol.2010, 47(2), 144-151]. The RNA was subjected to 1.5% agarose gel electrophoresis, observed and identified using a fluorescence-ultraviolet analyzer, and two clear bands could be seen. Analyze the total RNA sample with a UV / Vis spectrometer and measure the OD 260 / 280 =2.0, indicating good quality of total RNA. Total RNA samples were stored frozen at -80°C for later use.

[0091] First-strand cDNA was synthesized using High Fidelity PrimeScript RT-PCR Kit (p...

Embodiment 3

[0093] Example 3: Prokaryotic expression and protein purification of the sporozoan srldp1 gene

[0094] According to the nucleotide sequence of srldp1, the primers with corresponding restriction sites were designed (the underlined part of primer srldp1-EcoRI-F is the EcoRI restriction site, and the underlined part of primer srldp1-NotI-R is the NotI restriction site), The sequence is as follows:

[0095] srldp1-EcoRI-F:G GAATTC ATGGAACAAACTTTCCCCGCCACC

[0096] srldp1-NotI-R: AAAAGGAAAA GCGGCCGC TTAGTCGGAGTTCGTCGTCTCTTTT

[0097] The primers were all in the 5' to 3' direction.

[0098]Using the cloning vector pMD18T-srldp1 constructed in Example 2 as a template, use the primers srldp1-EcoRI-F and srldp1-NotI-R to amplify the sequence of the srldp1 coding region. The pET28a vector (recovering large fragments for ligation reaction) was transformed into E.coli DH5a chemically competent cells, and the correctly constructed recombinant plasmid was named pET28a-srldp1 ( ima...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Theoretical molecular weightaaaaaaaaaa
Login to View More

Abstract

The present invention relates to S.roseus lipid droplet protein 1, a coding gene and an application thereof. The S.roseus lipid droplet protein 1 is the following protein (a) or (b), wherein the protein (a) is a protein comprising the amino acid sequence represented by SEQ ID NO:1, and the protein (b) is a protein obtained by carrying out substitution and / or deletion and / or addition of one or a plurality of amino acids on the amino acid represented by SEQ ID NO:1, has the droplet protein related activity, and is derived from the SEQ ID NO:1. Results of green fluorescent protein co-localization and grease fermentation analysis demonstrate that the cell grease accumulation and storage amount can be significantly increased with the S.roseus lipid droplet protein 1 and the coding gene thereof. According to the present invention, a recombinant engineering strain capable of significantly increasing the grease accumulation amount is obtained through heterologous expression of the gene. The S.roseus lipid droplet protein 1 and the coding gene can be applied for construction of microorganism grease and fatty acid derivative production strains, and can further be used as a target for screening obesity patient treatment drugs.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to an oleaginous yeast lipid droplet protein and its gene and application. Specifically, the oleaginous yeast lipoprotein and the nucleotide encoding it are derived from Sporobolomyces roseus. The invention also provides a method for constructing the recombinant cell for oil production. Background technique [0002] Grease is a renewable resource with low oxygen content, high energy density, and moderate carbon chain length. It can replace fossil resources as the basic processing raw material for the chemical industry and renewable energy industry. It is a transition from a carbon-hydrogen economy to a carbon-hydrogen economy. The important link of its market potential is huge. Some microorganisms in nature can store more than 20% of the dry cell weight of oil in the cell under certain conditions (such as nitrogen source deficiency), among which triglyceride is the main one. Microorga...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/39C12N15/31C12N15/63C12N1/19C12N1/13C12N1/21C12R1/645C12R1/865C12R1/89C12R1/01
CPCC07K14/39
Inventor赵宗保朱志伟张素芳
OwnerDALIAN INST OF CHEM PHYSICS CHINESE ACAD OF SCI