Fusion protein of brucella outer membrane protein OMP25 and periplasmic protein BP26 as well as expression and application of the fusion protein

A technology of OMP25 and Brucella, applied in the field of fusion proteins

Pending Publication Date: 2020-11-24
SHANDONG BINZHOU ANIMAL SCI & VETERINARY MEDICINE ACADEMY
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no technical solution for simultaneously cloning two genes into an expression vector and inducing the expression of a fusion protein

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusion protein of brucella outer membrane protein OMP25 and periplasmic protein BP26 as well as expression and application of the fusion protein
  • Fusion protein of brucella outer membrane protein OMP25 and periplasmic protein BP26 as well as expression and application of the fusion protein
  • Fusion protein of brucella outer membrane protein OMP25 and periplasmic protein BP26 as well as expression and application of the fusion protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Gene Design and Recombinant Plasmid Synthesis and Expression of Brucella Outer Membrane Protein OMP25 and Periplasmic Protein BP26

[0047] 1. Main reagents

[0048] DNA Quick Ligation Kit, DL 2 000 Marker, rTaq, 6×DNA loading buffer enzyme, etc. were purchased from Dalian Baoriyi Biotechnology, 30% acrylamide, ammonium persulfate (APS), SDS, TEMED, SDS-PAGE protein loading Buffer (5×), Coomassie Brilliant Blue Rapid Staining Solution, protease inhibitors, nucleic acid dyes, etc. were purchased from Shandong Sikejie Scientific Instrument Co., Ltd., plasmid extraction kits, and gel recovery kits were purchased from Beijing Biotek Biotechnology Co., Ltd. IPTG, etc. were purchased from Sigma, and Rosetta (DE3) competent cells were preserved and made by our laboratory. Other reagents were domestic or imported analytically pure.

[0049] 2. Recombinant protein gene design

[0050]The amino acid sequences of Brucella outer membrane protein OMP25 and periplasmic protein BP2...

Embodiment 2

[0072] Fusion Protein Purification and Western Blot Analysis of Brucella Outer Membrane Protein OMP25 and Periplasmic Protein BP26

[0073] 1. Main reagents:

[0074] 30% acrylamide, ammonium persulfate (APS), SDS, TEMED, SDS-PAGE protein loading buffer (5×), Coomassie brilliant blue fast staining solution, skimmed milk powder, protease inhibitors, etc. were purchased from Shandong Sikejie Scientific Instruments Co., Ltd., His-nickel ion affinity chromatography column was purchased from GE Life Sciences, horseradish peroxidase (HRP) enzyme-labeled rabbit anti-goat * bovine secondary antibody was purchased from Henan Servi. Dialysis bags were purchased from Spectrum USA. Other reagents were domestic or imported analytically pure.

[0075] 2. Ni-column affinity chromatography purification of fusion protein

[0076] The fusion protein solution after ultrasonic cracking was purified by affinity chromatography using the AKATA protein purification system through His-nickel ion af...

Embodiment 3

[0084] Establishment and application of iELISA detection method based on fusion protein of OMP25 and BP26

[0085] 1. Main reagents

[0086] Triton-100 was purchased from Shandong Sikejie Scientific Instrument Co., Ltd., TMB was purchased from Beijing Tiangen Biochemical Technology Co., Ltd., horseradish peroxidase (HRP) enzyme-labeled rabbit anti-goat * bovine secondary antibody was purchased from Henan Servi. ELISA plates were purchased from Guangzhou Jiete Biological Filtration Products Co., Ltd. Other reagents were domestic or imported analytically pure.

[0087] 2. Establishment and optimization of fusion protein antibody iELISA detection method

[0088] 2.1 Optimum dilution of antigen and optimal dilution of serum optimization

[0089] Using the square array method, using the purified fusion protein as the coating antigen, set four dilutions of 1:25, 1:50, 1:100, 1:200, 1:400, respectively diluted with coating buffer and coated ELISA plate, 100 μL per well, choose thre...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a fusion protein of brucella outer membrane protein OMP25 and periplasmic protein BP26 as well as expression and application of the fusion protein. An N-terminal signal peptidesequence of the OMP25 protein and an N-terminal signal peptide sequence of the BP26 protein are deleted, and an antigenic determinant sequence of the OMP25 protein and the BP26 protein is reserved; the fusion protein is formed by connecting a Linker sequence GGAGGCGGGGGTTCTGGAGGCGGGGGTTCT in the middle; the N-terminal signal peptide sequence of the OMP25 protein is the first aa-29th aa, and the N-terminal signal peptide sequence of the BP26 protein is the first aa-24th aa. Compared with single protein, the protein is more economical, convenient and better in antigenicity. The protein is obtained with less time consumption and high yield, the culture and biological safety risks of viable bacteria are avoided, the specificity is strong, and the positioning of the Brucella cell epitope is more beneficial to reveal the essence of humoral immunity.

Description

technical field [0001] The invention relates to the technical field of fusion proteins, in particular to a fusion protein of Brucella outer membrane protein OMP25 and periplasmic protein BP26 and its expression and application. Background technique [0002] Brucellosis, also known as Mediterranean relaxation fever or Malta fever, is a zoonotic infectious disease characterized by abortion and fever caused by Brucella sp. It is prevalent in many countries and regions in the world. The high-incidence areas are the Mediterranean region, Asia, Central and South America, etc. It can cause a variety of animals and humans to become ill, and is a zoonotic infectious disease that mainly infringes on the reproductive system, seriously endangering animal health and human public health safety. Brucella is a Gram-negative facultative intracellular bacterium. The main hosts are pigs, cattle, sheep, dogs and other animals and humans. The transmission routes are mainly through the digestive...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/62C12N15/70C12N15/66C12P21/02A61K39/10A61P31/04G01N33/68G01N33/569G01N33/543G01N33/58C07K16/12
CPCC07K14/23C12N15/70C12N15/66A61K39/098A61P31/04G01N33/6854G01N33/56911G01N33/54393G01N33/581C07K16/1221C07K2319/40G01N2333/23G01N2469/20
Inventor吕素芳李峰董炳梅郭广君沈志强胡莉萍
OwnerSHANDONG BINZHOU ANIMAL SCI & VETERINARY MEDICINE ACADEMY