Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

45results about How to "Dangerous" patented technology

Method for preparing surface self-grown titanium nitride conducting film modified lithium titanate

The invention relates to a method for preparing a surface self-grown titanium nitride conducting film modified lithium titanate, which comprises the following steps of: uniformly mixing lithium titanate powder with solid nitrogen source in proportion in a dispersion medium in a mode of ultrasound or ball milling, drying the obtained slurry at the temperature of between70 and 120 DEG C, raising temperature to 600 to 900 DEG C in the inert protective atmosphere after grinding, preserving the heat for 10min to 1h, and then cooling together with a furnace to obtain the surface self-grown titanium nitride conducting film modified lithium titanate. Through heat nitrogen reaction, a layer of high-conductive film TiN is self-grown on the surface of the lithium titanate; the TiN film is firmly combined with the lithium titanate; and the prepared high-conductive Li4Ti5O12 / TiN material has high multiplying power of charge-discharge property and excellent circulating property. The preparation method has the advantages of low cost, simple operation and safety, and easy realization of mass production.
Owner:CENT SOUTH UNIV

Apparatus for precision steeling/conditioning of knife edges

A multi-stage sharpener includes at least one motor driven abrasive sharpening stage and one non-motor driven conditioning stage. The conditioning stage has a non-abrasive hardened surface and at least one precision knife guide which has a planar guide surface for creating a microscopic serration along the edge of a blade which had been sharpened in the first stage sharpening station. The sharpener may also include a third stage motor driven finishing stage. Alternatively, the conditioning stage can be incorporated as the knife edge modifying stage of a manual sharpener.
Owner:EDGECRAFT

Ship corrosion preventing method

The invention discloses a ship corrosion preventing method. The ship corrosion preventing method comprises the following steps of steel plate surface pre-treatment, base material sanding treatment, weld joint and other structure defect repair sand blasting, priming paint coating, strengthening paint spraying, finishing paint spraying and follow-up maintenance. According to the ship corrosion preventing method, steel plate surface pre-treatment is performed before coating, an epoxy anticorrosive coating is sprayed on the position with high rust-proof requirement, and whole spraying is performed after spraying; during whole spraying, corrosion resistant polyurethane serves as film forming matter, a coating for a framework formed by sheet metal flakes does not contain precious metal and toxic components and is a novel environment-friendly coating, flakes are formed and distributed on the material surface, multiple layers of flakes are horizontally arranged in an overlapped mode, a path for a corrosive medium to permeate into a base material is prolonged, and the corrosion preventing performance of the coating is improved. The ship corrosion preventing method is short in technological process, and produced ships have excellent rust, corrosion and fouling preventing performance.
Owner:QINGDAO WUWEI THERMAL INSULATION MATERIAL

Medical model based on 3D printing and manufacturing method thereof

The invention relates to the field of a medical model, particularly relates to a medical model based on 3D printing and a manufacturing method thereof and aims to provide a model for pre-operative simulation training. The method comprises steps that a three-dimensional digital model of target bones is constructed; a preset number of sub-models of the target bones are extracted; hole repair of a sub-model of each target bone is performed; a three-dimensional digital model of a target soft tissue / organ mold is constructed; according to the sub-models of the repaired target bones and the 3D digital model of the mold, 3D printing is performed to obtain a physical model of the target bones and the mold of the target soft tissue / organ; the physical model of the target soft tissue / organ is produced based on the mold obtained through 3D printing; the physical model of the target bones and the physical model of the target soft tissue / organ are combined to obtain a medical model. The method is advantaged in that the model simulation degree is high, effective pre-operative simulation training for medical staff can be performed;, and the success rate of surgery can be improved.
Owner:INST OF AUTOMATION CHINESE ACAD OF SCI +1

Organic fertilizer with insect expelling function

The invention discloses an organic fertilizer with an insect expelling function. The organic fertilizer is prepared from the following raw materials in parts by weight: 5-6 parts of Chinese honey locust, 150-155 parts of fresh sheep manure, 10-15 parts of soybeans, 1-2 parts of garlic, 1-2 parts of clove, 1-2 parts of oil residues, 10-20 parts of waste fruit, melon and vegetable peel, 10-20 parts of fish meal, 5-7 parts of radish peel, 1-2 parts of cassava alcohol residues, 4-6 parts of castor cakes, 5-7 parts of poria cocos, 4-6 parts of astragalus membranaceus, 1-2 parts of pepper leaves, 0.01-0.02 part of trichlorfon, 1-2 parts of red-spotted stonecrop, 2-6 parts of typhonium giganteum, 1-2 parts of radix aconiti agrestis and 0.4-0.5 part of an EM fungicide. The organic fertilizer is prepared through secondary fermentation treatment, is easy in obtaining raw materials, is convenient to use, comprehensive in nutrition, has the functions of yield increase and insect expelling, can do no harm to the soil environment, and is free of pollution or agricultural residues.
Owner:和县宝兰蔬菜种植有限公司

High-efficiency ocean anticorrosive paint

The invention discloses a high-efficiency ocean anticorrosive paint, which comprises the following active ingredients in parts by weight: 25-40 parts of fluorinated acrylate, 18-33 parts of silicone rubber, 3-10 parts of antirust pigment, 10-25 parts of filler, 0.1-1 part of chelating agent, 0.1-1 part of dispersing agent, and 0.1-1 part of wetting agent. According to the high-efficiency ocean anticorrosive paint, the silicone rubber and fluorinated acrylate materials have extremely low surface free energy, low friction coefficient, high hydrophobicity and high contamination releasing characteristic, so that the pollution and corrosion coefficients of steel can be lowered; the antirust pigment and filler are nanoscale particles, the nanoparticles and coatings form stronger hydrogen bonding, the compactness and ion permeability resistance of the coatings can be enhanced; through the nanoparticles, the rheological property of the paint can also be improved, and the adhesion force, hardness, finish degree and anti-aging properties of the coatings can be improved.
Owner:QINGDAO ADVANCED MARINE MATERIAL TECH

Preparation method of boronized silicon nitride fiber

The invention relates to a preparation method of a boronized silicon nitride fiber. The preparation method comprises the steps of firstly preparing a high-activity Si-N fiber by transforming an infusible polycarbosilane fiber, carrying out dehydrogenation coupling reaction on excessive N-H in the high-activity Si-N fiber and B-H compounds generated by virtue of pyrolysis of boron hydrides so as to chemically introduce an element B, and carrying out boron hydrides in ammonia gas, so as to prepare the boronized silicon nitride fiber. Compared with the prior art, the boronized silicon nitride fiber prepared by virtue of the preparation method is relatively high in boron content, nitrogen content and fiber strength and relatively uniform in boron distribution. The preparation method has the advantages that the process is simple and convenient, and the cost is low. Compared with SiBN fiber prepared by virtue of a polyborosilazane precursor route, the preparation method has relatively great cost advantage and is applicable to large-scale production, and existing decarburization-nitridation systems do not need to be changed.
Owner:NAT UNIV OF DEFENSE TECH

Automatic separation type seabed base suitable for soft and inclined seabed and laying method thereof

The invention provides an automatic separation type seabed base suitable for a soft and inclined seabed and a laying method of the automatic separation type seabed base. The automatic separation typeseabed base comprises a balance weightsystem and a seabed base platform, wherein the seabed base platform comprises an upper frame and a lower frame; the lower frame is of a cubic structure, the upperhalf part of the lower frame is a hollow frame, and the periphery and the top part of the lower half part of the lower frame are sealed by steel plates; eight stop discs are arranged at four cornersand on the frame of the bottom part of the lower frame; pore water pressure feeler levers are fixedly mounted below the stop discs at the four corners of the bottom part of the lower frame; the upperframe is arranged in the hollow frame on the upper half part of the lower frame and is fixed by means of a second trigger; a connecting rod is installed in the center of the upper frame, the top end of the connecting rod is movably connected with the counterweight system by means of a first trigger, and the connecting rod is hollow and internally provided with a mooring rope; and the other end ofthe mooring rope is connected with a floating ball. By means of the automatic separation type seabed base and the laying method thereof, the settlement amount is reduced, the monitoring equipment carrying level is guaranteed, whole-process automatic operation is achieved, and equipment recovery is safe and convenient.
Owner:OCEAN UNIV OF CHINA

Seabuckthorn flavone antioxidant electronic cigarette juice

ActiveCN104585871ASatisfy the demand for sensory quality of smokingHarm reductionTobacco treatmentLiquid smokeGlycerol
The invention discloses a seabuckthorn flavone antioxidant electronic cigarette juice which is prepared by mixing the following materials by weight percent: 5-10% of tobacco leaf extractives, 5-8% of tobacco flavors, 1-5% of tobacco spices, 5-15% of deionized water, 10-20% of glycerol, 3-15% of seabuckthorn flavone and the balance of propylene glycol, wherein the tobacco leaf extractives are preferably selected as Zimbabwe tobacco leaf extractives. The electronic cigarette juice provided by the invention contains seabuckthorn flavone, so that the electronic cigarette fragrance is more soft and delicate, the stimulation is reduced, the comfort is enhanced and the electronic cigarette juice has the health care functions of oxidation resistance and anti-aging. The electronic cigarette juice provided by the invention is used for atomizing the electronic cigarette, no tar and CO (carbon monoxide) are generated, the harm to the consumer is greatly reduced, and no second hand smoking damage is generated by the application of the electronic cigarette juice. The raw materials of the formula of the electronic cigarette juice containing the seabuckthorn flavone are easily acquired, and the seabuckthorn flavone antioxidant electronic cigarette juice is conformed to the international and national laws and regulations, and the production technique is simple.
Owner:CHINA TOBACCO SICHUAN IND CO LTD +1

Preparation method of SiBN fiber

The invention relates to a preparation method of SiBN fiber. The preparation method comprises the following steps: (1) preparing a high-activity Si-N fiber, namely adding an infusible polycarbosilane fiber into a decarburization-nitridation system, carrying out vacuumizing, replacing gas in the decarburization-nitridation system by virtue of nitrogen or argon until reaching an atmospheric pressure state, and repeating for at least three times; introducing high-purity ammonia gas, heating to 500 DEG C within 2 hours, after the temperature is increased to 700 DEG C at the speed of 0.90 DEG C / min-0.95DEG C / min, maintaining the temperature for 0.5 hour, heating until the temperature is 800-1200 DEG C at the speed of 100 DEG C / h, and maintaining the temeprature for 1-2 hours; introducing nitrogen / argon to cool to the room temperature, so as to obtain the high-activity Si-N fiber; (2) boronizing the high-activity Si-N fiber, namely heating until the temperature is 400-450 DEG C within 2 hours, introducing borane compound gas at least containing one B-H bond into the system, reacting for 24-36 hours, and introducing nitrogen / argon to cool to the room temperature; and (3) nitriding a boronized fiber, namely introducing high-purity ammonia gas, heating until the temperature is 1300-1400 DEG C within 6 hours, and maintaining the temperature for 1-2 hours; introducing nitrogen / argon to cool to the room temperature, so as to obtain the SiBN fiber. The preparation method is simple and convenient in process, low in cost and applicable to large-scale production, and existing decarburization-nitridation systems do not need to be changed.
Owner:NAT UNIV OF DEFENSE TECH

Three-dimensional atlas method for researching stress characteristics of working device of excavator

The invention relates to a three-dimensional atlas method for researching stress characteristics of a working device of an excavator. Kinematic and mechanical analysis is conducted on the whole excavator by obtaining the digging resistance coefficient and the resistance moment coefficient, and a theoretical digging force solving model is built; integrated finite element analysis is conducted on the working device on the basis of working device area planning to obtain the maximum stress values and corresponding area numbers of a movable arm, a bucket rod, a bucket and the whole working device, and the maximum stress values and spatial distribution of the areas where the maximum stress values are located are visually presented; finally, a dangerous working condition of a certain machine type is selected through stress research and compared with a classic working condition. The MBRS-3D method provides a new way for similar characteristic research.
Owner:CHONGQING UNIV

Major accident mitigation system of nuclear power station on basis of nano fluid characteristic

The invention discloses a major accident mitigation system of a nuclear power station on the basis of the nano fluid characteristic, belonging to the technical field of nuclear power station equipment and safety. The system is composed of a superconductive tube, a heat exchanger, a radioactive grain removing device, a nano fluid preparation chamber, an ultrasonic oscillator, an air cooling tower and the like. The system can quickly adsorb energy in a containment under the major accident, hyperpressure in the containment can be alleviated by releasing and removing radioactive air and radioactive aerosol particles, nano particles can be obtained, and the efficient heat exchange medium nano fluid can be prepared to achieve the goal of alleviating the major accident of the reactor and protecting the integrity of the containment structure. A safety control function is performed and finished when major accidents happen. The system has the advantages of good backup safety, simple flow, stable performance and high reliability, is convenient to implement and simple to control, and treats wastes with wastes.
Owner:NORTH CHINA ELECTRIC POWER UNIV (BAODING)

Hydrogenophaga sp. H7 capable of degrading aromatic compounds and removing nitrogen and arsenic, and application thereof

The invention specifically relates to Hydrogenophaga sp. H7 capable of degrading aromatic compounds and removing nitrogen and arsenic, and application thereof, belonging to the technical field of application of environmental microorganisms. The Hydrogenophaga sp. H7 belongs to Hydrogenophaga sp. and is preserved in China Center for Type Culture Collection under the accession number CCTCC No. M2018149. The arsenic oxidizing bacterium Hydrogenophaga sp. H7 of the invention is an arsenic oxidizing bacterium capable of degrading various aromatic compounds such as 3-hydroxybenzoic acid, 4-hydroxybenzoic acid, benzoic acid and phenol, and the bacterium can oxidize As<3+> with high toxicity into As<5+> with low toxicity and degrade aromatic compounds such as 3-hydroxybenzoic acid and 4-hydroxybenzoic acid. The bacterium is also a denitrifying bacterium which has great potential in clearing pollution in composite contaminated areas and also has application value in removing nitrogen pollution.
Owner:HUAZHONG AGRI UNIV

Environment-friendly and energy-saving steam cleaning machine

The invention discloses an environment-friendly and energy-saving steam cleaning machine, which relates to the technical field of steam cleaning, and comprises a main machine and a storage device, a water tank is arranged in the main machine, a water pump is arranged at one end in the water tank, an electromagnetic water inlet valve is arranged at the right end outside the water tank, and a metalcasting is arranged at one end outside the electromagnetic water inlet valve; a metal pipe is arranged in the metal casting, an electric heating pipe is installed outside the metal pipe, a pressure sensor is arranged at the end, close to the water tank, of the metal pipe, and a safety pressure valve is installed at the end, away from the water tank, of the metal pipe. During work, the water pump conveys high-pressure water flow to the metal pipe, the electric heating pipe rapidly heats the metal pipe, the water flow is rapidly converted into high-pressure steam in the metal pipe, the high-pressure steam flows to the steam spray gun through the high-pressure steam conveying pipe, and the high-pressure steam can be sprayed out towards a muzzle as long as a worker opens a trigger switch of asteam spray gun, and high-pressure steam flow or high-pressure steam-water mixed jet flow capable of cleaning a vehicle body is generated.
Owner:SHANTOU JIENENG ELECTRICAL APPLIANCE TECH

A kind of preparation method of lignin micro/nanosphere

ActiveCN110452396BDoes not change the chemical structureShape is easy to controlNanotechnologyMicro nanoActive agent
The invention provides a preparation method of lignin micro / nano spheres, which mainly relates to preparation of lignin spherical micro / nanoparticles in an organic solvent-water system and can fulfillshape and size controllable aim by controlling preparation conditions such as organic solvent type, temperature, surfactant, stirring speed and solvent dropping speed. The preparation method of the lignin micro / nano spheres comprises the following steps: dissolving a proper amount of lignin into the organic solvent and adding water to obtain uniform mixed liquid; and evaporating the organic solvent to obtain the lignin micro / nano spheres with uniform size and regular shape. The preparation method of the lignin micro / nano spheres is simple and convenient in operation, low in equipment requirement and short in production period, chemical modification of the lignin and use of chemical agents with high toxicity are avoided, cost is saved and environmental pollution is reduced; furthermore, raw materials are low in price and wide in source, and high-value utilization of lignin resources can be realized.
Owner:SOUTH CHINA AGRI UNIV

Parking obstacle detection method and device

The invention provides a parking obstacle detection method and device. The method comprises the following steps of: starting an ultrasonic sensing device to collect and obtain multiple sets of obstacle distance information; solving a difference value between each piece of distance data in the next group of obstacle distance information and one piece of distance data in the previous group of obstacle distance information; screening out candidate difference values within the dynamic range from the difference values; screening out the candidate difference value with the minimum later distance data from the candidate difference values to serve as a target candidate difference value, and determining the front distance data and the rear distance data corresponding to the target candidate difference value as dynamic trajectory data of the nearest obstacle; and outputting alarm information according to the dynamic trajectory data. According to the parking obstacle detection method, multiple sets of obstacle distance information can be collected, real obstacles and false obstacles can be screened out, two pieces of dynamic trajectory data of the real obstacle closest to the automobile are obtained, and warning information is output according to the dynamic trajectory data of the closest obstacle to assist a driver in parking operation.
Owner:STEELMATE CO LTD

A preparation method of nitrogen-doped carbon nanomaterial and its application in hydrogenation reaction of nitrobenzene

A preparation method of nitrogen-doped carbon nanomaterials and its application in nitrobenzene hydrogenation reaction. The invention discloses a preparation method of nitrogen-doped carbon nanomaterials derived from nitrogen-rich covalent organic framework materials, Nitrogen-doped carbon nanomaterials were obtained by high-temperature carbonization of nitrogen-rich covalent organic framework materials, which were used to catalyze the hydrogenation reaction of nitrobenzene. The preparation method of the precursor of the nitrogen-doped carbon nanomaterial is simple, the process of preparing the nitrogen-doped carbon nanomaterial is simple and time-consuming, the selectivity of catalyzing the hydrogenation of nitrobenzene to generate aniline is high, and the utilization rate of the catalyst is high, which can be used in Industrialized mass production.
Owner:JILIN INST OF CHEM TECH

System and method for collection of agricultural activity process data

The present invention discloses a system and method for collection of agricultural activity process data. The system comprises an integrated data management platform, an agricultural activity map board, a plurality of monitoring terminals and solar charging systems being correspondingly electrically connected with the monitoring terminals. Each monitoring terminal comprises a photographing module,a data transmission module, a timing setting module, a memory module, a rechargeable battery, a GPS positioning module and a 3D acceleration sensor. The integrated data management platform is configured to perform data summary statistical processing of images or videos, GPS positioning coordinate data, motion acceleration data, crop agricultural activity process manuals and agricultural activityprocess data obtained by the monitoring terminals. The system and method for collection of agricultural activity process data integrate event collection, image capture, production early warning and plan comparison into one body for remote monitoring of the growth of crops and realization of automatic capture and video recording to perform auxiliary evidence, and have the advantages of easy carrying, personnel danger tip, mobile phone short message positioning and early warning search function, etc.
Owner:成都金雅图科技有限公司

Emulsion for high-gloss acrylic paint and containing modified graphene and preparation method thereof

The invention discloses an emulsion for high-gloss acrylic paint and containing modified graphene and a preparation method thereof. The emulsion obtained by adding oleic acid-lauryl sodium sulfate modified graphene forms a conductive path uniform in dispersity and conductivity, the problem that conventional methods in which graphene is added directly are low in dispersity and nonuniform in conductivity is solved, the emulsion has excellent heat resistance and stability, and thermal performance is improved by 50 DEG C when compared with a pure acrylic emulsion without modified graphene; the emulsion is high in gloss up to higher than 80.6.
Owner:广州锋凌新材料科技有限公司

Preparation method of boron-doped silicon nitride fiber

Disclosed is a preparation method of a boron-doped silicon nitride fiber. The preparation method comprises: preparing a high-activity Si-N fiber by adopting conversion of a dis-molten polycarbosilane fiber; realizing chemical introduction of the B element by utilizing HX elimination reaction between spare N-H in the high-activity Si-N fiber and borazine containing a B-X (X=H, Cl, Br, and I) bond; and performing nitridation in ammonia gas to prepare the boron-doped silicon nitride fiber. Compared with the prior art, the boron-doped silicon nitride fiber prepared through the method in the invention is relatively high in boron content, nitrogen content, and fiber strength, and is uniform in dispersion. According to the invention, the technology is simple; the cost is low; and no change is needed in a current decarburization-nitridation system, so that the preparation method is suitable for mass production.
Owner:NAT UNIV OF DEFENSE TECH

Fusion protein of brucella outer membrane protein OMP25 and periplasmic protein BP26 as well as expression and application of the fusion protein

The invention discloses a fusion protein of brucella outer membrane protein OMP25 and periplasmic protein BP26 as well as expression and application of the fusion protein. An N-terminal signal peptidesequence of the OMP25 protein and an N-terminal signal peptide sequence of the BP26 protein are deleted, and an antigenic determinant sequence of the OMP25 protein and the BP26 protein is reserved; the fusion protein is formed by connecting a Linker sequence GGAGGCGGGGGTTCTGGAGGCGGGGGTTCT in the middle; the N-terminal signal peptide sequence of the OMP25 protein is the first aa-29th aa, and the N-terminal signal peptide sequence of the BP26 protein is the first aa-24th aa. Compared with single protein, the protein is more economical, convenient and better in antigenicity. The protein is obtained with less time consumption and high yield, the culture and biological safety risks of viable bacteria are avoided, the specificity is strong, and the positioning of the Brucella cell epitope is more beneficial to reveal the essence of humoral immunity.
Owner:SHANDONG BINZHOU ANIMAL SCI & VETERINARY MEDICINE ACADEMY

A 3D Atlas Method for Studying the Stress Characteristics of Excavator Working Devices

The invention relates to a three-dimensional atlas method for researching stress characteristics of a working device of an excavator. Kinematic and mechanical analysis is conducted on the whole excavator by obtaining the digging resistance coefficient and the resistance moment coefficient, and a theoretical digging force solving model is built; integrated finite element analysis is conducted on the working device on the basis of working device area planning to obtain the maximum stress values and corresponding area numbers of a movable arm, a bucket rod, a bucket and the whole working device, and the maximum stress values and spatial distribution of the areas where the maximum stress values are located are visually presented; finally, a dangerous working condition of a certain machine type is selected through stress research and compared with a classic working condition. The MBRS-3D method provides a new way for similar characteristic research.
Owner:CHONGQING UNIV

Bamboo juice/blackberry compounded nutritious snakehead feed and production method thereof

The invention discloses bamboo juice / blackberry compounded nutritious snakehead feed. The bamboo juice / blackberry compounded nutritious snakehead feed is prepared from the following raw materials in parts by weight: 10-13 parts of chicken blood, 12-15 parts of duck blood, 0.7-1.2 parts of thymus mongolicus powder, 15-18 parts of wheat germs, 14-17 parts of celery, 16-19 parts of blackberries, 17-21 parts of bamboo juice, 5-8 parts of fructus alpiniae oxyphyllae, 15-19 parts of barley, 13-15 parts of straw powder, 14-18 parts of rape seed cake, 6-9 parts of onion powder, 2-4 parts of a folium mori extracting solution, 0.3-0.5 part of angelica dahurica, 0.2-0.4 part of flowers of pueraria lobata, 0.1-0.4 part of acanthopanax senticosus, 5-8 parts of an addition agent and a proper amount of water. The feed uses simple materials, has no pollution and no chemical residues, and has balanced nutrition and a good suspension property; with the bamboo juice and the blackberries, the feed has the effects of clearing away heat and toxic materials; meanwhile, many effective Chinese herbal medicines are added into the feed, and damage, caused by antibiotics, hormones and the like used in the prior art, to the growth of snakeheads and body health of eaters is avoided, the death rate of snakeheads is reduced and the immunity of snakeheads is improved; therefore, the nutritious snakehead feed has wide application prospects.
Owner:当涂县龙皇水产养殖专业合作社

A seabuckthorn flavonoid antioxidant electronic cigarette liquid

ActiveCN104585871BSatisfy the demand for sensory quality of smokingHarm reductionTobacco treatmentLiquid smokeGlycerol
The invention discloses a seabuckthorn flavone antioxidant electronic cigarette juice which is prepared by mixing the following materials by weight percent: 5-10% of tobacco leaf extractives, 5-8% of tobacco flavors, 1-5% of tobacco spices, 5-15% of deionized water, 10-20% of glycerol, 3-15% of seabuckthorn flavone and the balance of propylene glycol, wherein the tobacco leaf extractives are preferably selected as Zimbabwe tobacco leaf extractives. The electronic cigarette juice provided by the invention contains seabuckthorn flavone, so that the electronic cigarette fragrance is more soft and delicate, the stimulation is reduced, the comfort is enhanced and the electronic cigarette juice has the health care functions of oxidation resistance and anti-aging. The electronic cigarette juice provided by the invention is used for atomizing the electronic cigarette, no tar and CO (carbon monoxide) are generated, the harm to the consumer is greatly reduced, and no second hand smoking damage is generated by the application of the electronic cigarette juice. The raw materials of the formula of the electronic cigarette juice containing the seabuckthorn flavone are easily acquired, and the seabuckthorn flavone antioxidant electronic cigarette juice is conformed to the international and national laws and regulations, and the production technique is simple.
Owner:CHINA TOBACCO SICHUAN IND CO LTD +1

Oleanolic acid health care wine

The invention provides an oleanolic acid health care wine consisting of edible wine and oleanolic acid. The invention is characterized in that the edible wine and the oleanolic acid are mixed in the mass ratio of 1:0.001-0.003 to obtain the oleanolic acid health care wine. The oleanolic acid health care wine can better prevent damage of drinking to liver.
Owner:宁蒗女儿珍生物工程有限公司

A kind of preparation method of boron-containing silicon nitride fiber

The invention relates to a preparation method of silicon nitride fiber containing boron. Firstly, high-activity Si-N fiber is prepared by converting polycarbosilane non-melting fiber, then chemical introduction of a B element is realized by utilizing H2 elimination reaction between excessive N-H in the high-activity Si-N fiber and high-chemical activity boron compound gas, and then nitridation is performed in ammonia gas, so as to prepare the silicon nitride fiber containing boron. Compared with the prior art, the silicon nitride fiber containing boron, which is prepared by adopting the method, has the advantages of high boron content, uniformity in distribution, high nitrogen content and high fiber strength. The preparation method has the advantages of simple process and low cost and is suitable for large-scale production, and an existing decarburization-nitridation system does not need to be changed.
Owner:NAT UNIV OF DEFENSE TECH

A kind of preparation method of boronizing silicon nitride fiber

The invention relates to a preparation method of a boronized silicon nitride fiber. The preparation method comprises the steps of firstly preparing a high-activity Si-N fiber by transforming an infusible polycarbosilane fiber, carrying out dehydrogenation coupling reaction on excessive N-H in the high-activity Si-N fiber and B-H compounds generated by virtue of pyrolysis of boron hydrides so as to chemically introduce an element B, and carrying out boron hydrides in ammonia gas, so as to prepare the boronized silicon nitride fiber. Compared with the prior art, the boronized silicon nitride fiber prepared by virtue of the preparation method is relatively high in boron content, nitrogen content and fiber strength and relatively uniform in boron distribution. The preparation method has the advantages that the process is simple and convenient, and the cost is low. Compared with SiBN fiber prepared by virtue of a polyborosilazane precursor route, the preparation method has relatively great cost advantage and is applicable to large-scale production, and existing decarburization-nitridation systems do not need to be changed.
Owner:NAT UNIV OF DEFENSE TECH

Modular ecological proliferation bed

PendingCN112806293APlenty of spaceMeet the needs of biological seasonal movementClimate change adaptationPisciculture and aquariaOpen seaNutrition
The invention discloses a modular ecological proliferation bed. A proliferation bed body of the modular ecological proliferation bed comprises a plurality of fish reef units which are assembled with one another; each fish reef unit comprises basalt grating, a plurality of stand columns and a plurality of basalt pipe fittings. the plurality of stand columns are pressed on the basalt grating; each basalt pipe fitting is of a hollow tubular structure, and a plurality of open holes are formed in the pipe wall of the basalt pipe fitting in a staggered mode; the two ends of the basalt pipe fittings are connected to the two stand columns respectively, and the stand columns are connected through the basalt pipe fittings; and the adjacent fish reef units share the stand columns and the basalt pipe fittings. The modular ecological proliferation bed is a multi-nutrition-level artificial fish reef for providing habitats for breeding, bait, growth and the like for benthic shellfishes, tropical sea cucumbers and macroalgae, the modular artificial fish reef small units combined with multiple nutrition levels are infinitely combined and extended, the modular artificial fish reef can be put according to the submarine topography, the submarine space is fully utilized, and multi-nutrition-level proliferation on sea cucumbers, shellfishes and macroalgae in the open sea island reefs can be realized.
Owner:HAINAN ACADEMY OF OCEAN & FISHERIES SCI

Method for reducing osmium secondary absorption liquid

PendingCN114807622AControl sedimentation rateDangerousOsmium MetallicumReducing agent
The invention discloses a method for reducing secondary osmium absorption liquid, which comprises the following steps: adjusting the pH value of the secondary osmium absorption liquid to 5-7, and controlling the concentration of the secondary osmium absorption liquid to be 25-30g / L; and heating the secondary osmium absorption liquid to 55-65 DEG C, adding an ethanol solution, reacting for 1-2 hours at the constant temperature of 55-65 DEG C, filtering and washing to obtain the metal osmium. The ethanol solution is used for replacing hydrazine hydrate reduction osmium secondary absorption liquid, so that the cost is reduced. According to the method, the pH of the osmium secondary absorption liquid is adjusted before the ethanol solution is added, so that the osmium precipitation rate of the osmium absorption liquid can be effectively controlled; hydrazine hydrate is replaced with an ethanol solution, and due to the fact that hydrazine hydrate is a strong reducing agent and has certain dangerousness, the safety risk is reduced; according to the method, the osmium absorption liquid is heated to 55-65 DEG C before the ethanol solution is added for reduction, the reduction efficiency is effectively improved, the osmium reduction rate is larger than or equal to 99%, and the content of osmium in the liquid after reaction is smaller than or equal to 0.01 g / L.
Owner:JINCHUAN GROUP LIMITED

Automatic cruise algorithm for tailing pond dry beach length and beach crest elevation

The invention relates to an automatic cruise algorithm for tailing pond dry beach length and beach crest elevation. The method includes the steps of: 1. placing a dry beach measuring instrument at a high spot near a tailing pond, measuring and recording the elevation of the dry beach measuring instrument; 2. presetting a dry beach length cruise track and a beach crest elevation cruise track, seeking a dry beach length measurement point according to the dry beach length cruise track, and seeking a beach crest elevation measurement point according to the beach crest elevation cruise track; 3. recording the distance between the dry beach measuring instrument and the dry beach length measurement point, a horizontal cruise angle and a vertical cruise angle; selecting two reference points on a dam body, recording the distances from the dry beach measuring instrument to the two dam body reference points, horizontal cruise angles and vertical cruise angles, and calculating the dry beach length; and 4. recording the distance between the dry beach measuring instrument and the beach crest elevation measurement point, a horizontal cruise angle and a vertical cruise angle, and calculating the beach crest elevation. The method solves the problems of low accuracy of manual measurement because of environmental constraints in the prior art.
Owner:XIAN TECHNOLOGICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products