A strain of Fusarium oxysporum and its application
A technology of Fusarium oxysporum and spore suspension, which is applied in the field of microorganisms, can solve the problems of high cost and large secondary pollution, and achieve the effects of low cost, small secondary pollution and high recovery rate
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Example 1: Fusarium oxysporum isolation and culture
[0036] Prepare 30 mL of sterile water (put deionized water in an autoclave, sterilize at 121 °C for 25 min), and 5 g of soil samples collected (sampling location: Luoyuan Bay Red, Luoyuan County, Fuzhou City, Fujian Province) The shoal of the tidal flat in Shulin Park, sampling time in November 2018) was added to sterile water, shaken well, and 100 μL of turbid solution (dilution with different concentration gradients: 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 ) in PDA solid medium (potato 200 g / L, glucose 20 g / L, streptomycin 0.03 g / L, agar 20 g / L) and coated with a coating rod, and then placed in a 37°C incubator for cultivation. After the fungus grows in the solid medium, a single colony is picked out on the PDA slant medium for pure culture to obtain a pure culture of Fusarium oxysporum, and the pure culture of Fusarium oxysporum is identified.
[0037] The colony morphology of the isolated pure culture of Fusar...
Embodiment 2
[0038] Example 2: Identification of Fusarium oxysporum
[0039] The identification of experimental fungal species is to use ITS rDNA as the marker fragment, amplify the ITS sequence in the gene through primers, and compare it with the NT database to obtain species information of similar sequences, and use the method of homology alignment to assist in judging species information. ITS primer sequences ITS1: TCCGTAGGTGAACCTGCGG and ITS4: TCCTCCGCTTATTGATATGC
[0040] The ITS sequence in the gene of Fusarium oxysporum was amplified by PCR using the genomic DNA of Fusarium oxysporum as the template. PCR reaction conditions were: 95°C for 5 min; 95°C for 30s, 56°C for 30s, 72°C for 90s, cycle 25 times; 72°C for 10 min. Electrophoresis conditions: 1% agarose gel, electrophoresis at 120 V for 30 min. The gene sequence of Fusarium oxysporum obtained by sequencing is shown below.
[0041] gene sequence:
[0042] tcttccgtaaggggtacCTGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCCTGTGAACATACCTTA...
Embodiment 3
[0044] Example 3: Urease-producing properties of Fusarium oxysporum
[0045] Fusarium oxysporum FZU-07 was inoculated into urea agar medium (peptone: 1 g, sodium chloride: 5 g, potassium dihydrogen phosphate: 2 g, phenol red: 0.012 g (0.2% phenol red solution 6 mL) , urea: 2% (w / v) i.e. 20 g, glucose: 1 g, agar: 15 g, PH: 7.0 ± 0.1), placed in a 37 °C incubator for 3 days, it can be observed that the inoculation of Fusarium oxysporum The color of the urea agar medium changes from yellow to red. It is due to the production of urease by Fusarium oxysporum, which can decompose urea into NH 3 and CO 2 , NH 3 It is alkaline and changes the color of the phenol red indicator.
PUM
| Property | Measurement | Unit |
|---|---|---|
| concentration | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More