High-yield culture medium for producing pleomycin E from deep-sea streptomyces gene engineering mutant strain and large-scale fermentation process of high-yield culture medium

A technology of genetically engineered strains and elamycin, applied in genetic engineering, microorganism-based methods, fermentation, etc., can solve the problems of low yield of elamycin E, restricting the research on biological activity of elamycin E system, etc. , to achieve the effect of being conducive to popularization and application, high flux of secondary metabolic pathways, and increasing titer

Pending Publication Date: 2022-05-27
EAST CHINA UNIV OF SCI & TECH
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the yield of Eloomycin E in the initial fermentation process is very low, which seriously restricts the systematic biological activity research of Eloomycin E and becomes the bottleneck of preclinical research

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High-yield culture medium for producing pleomycin E from deep-sea streptomyces gene engineering mutant strain and large-scale fermentation process of high-yield culture medium
  • High-yield culture medium for producing pleomycin E from deep-sea streptomyces gene engineering mutant strain and large-scale fermentation process of high-yield culture medium
  • High-yield culture medium for producing pleomycin E from deep-sea streptomyces gene engineering mutant strain and large-scale fermentation process of high-yield culture medium

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] Example 1 Construction of SCSIO ZH16ΔilaR strain

[0063] The S.atratus SCSIO ZH16ΔilaR strain of the present invention is obtained by using the gene knockout plasmid PKCCas9dilaR to knock out the ilaR gene in S.atratus SCSIO ZH16 based on the CRISPR-Cas9 gene editing technology. Specific steps are as follows:

[0064] First, the PKCCas9dO plasmid cut with the restriction enzymes SpeI and HindIII was ligated with the 1173 bp upstream fragment and the 1109 bp downstream fragment of the guide RNA assembled at the 190th base region of the ilaR gene by the method of restriction endonucleases SpeI and HindIII, and then transformed into The PKCCas9dilaR recombinant plasmid was obtained from E.coil DH5α. The sequence of the guide RNA is shown in SEQ ID NO.1.

[0065] Guide RNA:

[0066] ATTCCAAGGACGACGGAAAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC, SEQ ID NO. 1.

[0067] The upstream fragment containing the guide RNA is based on the Strept...

Embodiment 2

[0081] 1. Optimization of carbon and nitrogen sources

[0082] By screening more than 20 kinds of medium, the medium formula was determined to be 120g of glucose, 20g of soybean powder, 2.4g of corn steep liquor, 6g of sodium chloride, 9.6g of sodium nitrate, 6.4g of ammonium sulfate, 0.24g of potassium dihydrogen phosphate, and 9.6g of calcium carbonate. g. The glucose in the basal fermentation medium was replaced by maltose, sucrose, mannitol and soluble starch, respectively. The mass fraction of each carbon source was the same, and the other components were unchanged. Soybean powder was replaced with yeast extract, yeast extract powder, peptone, malt extract, and beef extract respectively. The mass fraction of each nitrogen source was the same, and other components were unchanged. The experimental results are as Figure 1 to Figure 2 shown. figure 1 and figure 2 The results showed that the optimal carbon source was soluble starch, and the optimal nitrogen source was so...

Embodiment 3

[0094] Example 3 Experimental design, data analysis and detection results

[0095] The Plackett-Burman experimental design can analyze the significance of the response values ​​of multiple different factors to find the medium components that are most important for fermentation titer or cell growth, and take the highest (+1) for each factor. and low (-1) two levels, through the statistical analysis between the difference between the two levels of each factor and the overall difference to determine the significance of each factor to the corresponding variable. Through the design of Design Expert 12 data processing software, 8 influencing factors are selected in this experiment, and the PB experimental design table with N=12 is selected. The factors and levels represented by each parameter are shown in the table (see Table 1 and Table 2). X in Table 1 1 , X 2 , X 3 , X 4 , X 5 , X 6 , X 7 , X 8 Respectively represent soluble starch, soybean flour, corn steep liquor, sodi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a high-yield culture medium for producing pleomycin E. The high-yield culture medium is prepared from the following components in parts by weight: 96 to 144 g of soluble starch, 16 to 24 g of soybean meal, 1.92 to 2.88 g of corn steep liquor, 4.8 to 7.2 g of sodium chloride, 7.68 to 11.52 g of sodium nitrate, 5.12 to 7.68 g of ammonium sulfate and 0.192 to 0.288 g of monopotassium phosphate, the components are dissolved in deionized water, the volume is fixed to 1000 mL, the pH is adjusted to 7.2 to 7.4 by using a 3M sodium hydroxide solution, and then 1.53 to 17.67 g of calcium carbonate is added. The invention also discloses a large-scale fermentation process for producing pleomycin E by using the high-yield culture medium. The high-yield culture medium is easy in raw material obtaining, low in price and beneficial to popularization and application. And the yield of the pleomycin E can be improved.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a high-yield culture medium for producing elamycin E by a genetically engineered mutant strain of Streptomyces deep-sea and a large-scale fermentation process thereof. Background technique [0002] The deep sea has a complex and unique environment. Compared with the shallow sea, it varies greatly in terms of light, oxygen concentration, pressure, available nutrients, salinity and temperature. important source. The unique environment of the deep sea promotes the formation of unique physiological and metabolic capabilities of deep-sea organisms, which not only ensures their survival, but also provides the potential for their production of novel metabolites. Today, marine bioactive compounds are playing an increasingly important role in the development of functional foods and drugs based on their potent antibacterial, antitumor, and antioxidant properties. [0003] S.atrat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12P21/04C12N1/21C12N15/76C12N15/53C12R1/465
CPCC12P21/02C07K7/64C12N1/20C12N15/76C12N9/0081C12Y114/15006
Inventor安法梁郑高帆朱云飞鞠建华马俊英
OwnerEAST CHINA UNIV OF SCI & TECH