Efficient endoglucanase RuCelB, coded gene, preparation method and application thereof
An endoglucanase and encoding gene technology, applied to the field of endoglucanase and its preparation, can solve problems such as low enzyme activity and achieve the effect of good thermal stability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Example 1 The construction of Chinese yak rumen microbial metagenomic DNA library
[0037] The rumen contents of 2 Chinese Qinghai yaks were collected from a slaughterhouse in Xining City, filtered through three layers of gauze, the filtrate was centrifuged to collect rumen microbial cells, and frozen at -80°C until use. Take 100-200ul bacterial sample, wash 2-3 times with 1ml PBS, add 650uL DNA extraction buffer (Tris-HCl, 100mM pH8.0; Na 2 EDTA 100mM pH8.0; Na 3 PO 4 Buffer 100mM pH8.0; NaCl 1.5M; CTAB 1%; pH8.0), mix well, place in -80℃, then place in 65℃ water bath to melt, repeat three times; add 3-4μL lysozyme after cooling ( 100mg / L) shake horizontally (37°C, 225rpm) in a shaker for about 30min; add 2-3μL proteinase K (20mg / mL) and continue shaking for about 30min; add 50-70uL SDS (20%), mix well, Incubate at 65°C for 1-2h, invert the centrifuge tube up and down every 10-20min to mix; centrifuge at 12,000rpm for 10min at room temperature, collect the supernat...
Embodiment 2
[0040] Cloning and sequence analysis of RuCelB gene derived from embodiment 2 rumen microorganisms
[0041] The endoglucanase gene on 6C6 was cloned into the pGEM11z vector by subcloning method: the cosmid plasmid of the screened positive clone 6C6 was partially digested with Sau3A I into a 2-5kb fragment, and then ligated into a fragment digested with BamHI In the pGEM11z vector with dephosphorylation, transform DH5α, and perform functional screening on the subclone library by the method described in Example 1. The obtained subclone is sequenced with T7 and SP6 general primers, and the endoglucan is determined by homologous comparison. The coding region sequence of the carbohydrase gene, its gene nucleotide sequence is shown in SEQ ID NO 1, and named as RuCellB.
[0042] The gene cds encodes 336 amino acids, the ORF sequence is shown in SEQ ID NO 2, and the theoretical molecular weight is 38.4kD. Using SMART to analyze the structural domain, it was shown that the 24 amino ac...
Embodiment 3
[0043] Recombinant expression of embodiment 3 RuCelB gene in escherichia coli
[0044] In order to clone the RuCelB gene sequence into the Escherichia coli expression vector pET-21a for recombinant expression, a pair of primers were designed: the forward primer added 6 His codons, skipped the signal peptide, and amplified from the 25th position of the protein, The sequence is RuCelBF:ATA GAATTC CATCATCACCATCATCACGGCAACGGCTGGGTC, reverse primer is RuCelBR:TGT AAGCTT ACCCGCCT GTCCCTG, the underlined restriction enzyme sequence. The RuCelB gene fragment was amplified by PCR reaction. After gel recovery, it was digested with EcoR I and Hind III. After the fragment was recovered, it was ligated with the pET-21a vector that was also digested with EcoR I and Hind III. The ligated product was transformed into Escherichia coli For the Top10 strain, the obtained transformants were identified by cooking PCR using the above primers, and the transformants containing the 1 kb amplified ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap