High-efficiency endoglucanase rucelb, its coding gene, preparation method and application

An endoglucanase and encoding gene technology, applied to the field of endoglucanase and its preparation, can solve problems such as low enzyme activity and achieve the effect of good thermal stability

Active Publication Date: 2015-12-02
FUDAN UNIV
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although endocellulase is very important in degrading cellulose, its enzyme activity is often relatively low relative to its role, and soluble substrates are commonly used to screen and evaluate enzyme activity, but using soluble The specific activity data measured by the substrate cannot really represent the activity when hydrolyzing lignocellulose, because the endocellulase that is really active on insoluble substrates, especially crystalline insoluble substrates, is relatively small, and the insoluble substrates The enzymatic activity of the endocellulase is often very low even if it exists. The contradiction between this cloning strategy and the actual application requirements has caused most of the endocellulase to have little practical application value.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High-efficiency endoglucanase rucelb, its coding gene, preparation method and application
  • High-efficiency endoglucanase rucelb, its coding gene, preparation method and application
  • High-efficiency endoglucanase rucelb, its coding gene, preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1 The construction of Chinese yak rumen microbial metagenomic DNA library

[0037] The rumen contents of 2 Chinese Qinghai yaks were collected from a slaughterhouse in Xining City, filtered through three layers of gauze, the filtrate was centrifuged to collect rumen microbial cells, and frozen at -80°C until use. Take 100-200ul bacteria samples, wash 2-3 times with 1ml PBS, add 650uL DNA extraction buffer (Tris-HCl, 100mMpH8.0; Na 2 EDTA100mMpH8.0; Na 3 PO 4 Buffer100mMpH8.0; NaCl1.5M; CTAB1%; pH8.0), after mixing, place in -80°C, then place in a 65°C water bath to melt, repeat three times; add 3-4μL lysozyme (100mg / L ) shake horizontally (37°C, 225rpm) in a shaker for about 30min; add 2-3μL proteinase K (20mg / mL) and continue to shake for about 30min; add 50-70uLSDS (20%), mix well, and incubate at 65°C for 1 -2h, invert the centrifuge tube up and down every 10-20min to mix; centrifuge at 12,000rpm for 10min at room temperature, collect the supernatant, add ...

Embodiment 2

[0040] Cloning and sequence analysis of RuCelB gene derived from embodiment 2 rumen microorganisms

[0041] The endoglucanase gene on 6C6 was cloned into the pGEM11z vector by subcloning method: the cosmid plasmid of the screened positive clone 6C6 was partially digested with Sau3AI into a 2-5kb fragment, ligated into a fragment digested with BamHI and In the dephosphorylated pGEM11z vector, transform DH5α, and perform functional screening on the subcloned library by the method described in Example 1. The obtained subclones are sequenced with T7 and SP6 universal primers, and the endoglucan is determined by homologous comparison The coding region sequence of the enzyme gene, its gene nucleotide sequence is shown in SEQIDNO1, and named as RuCelB.

[0042] The gene cds encodes 336 amino acids, the ORF sequence is shown in SEQ ID NO2, and the theoretical molecular weight is 38.4kD. Using SMART to analyze the structural domain, it was shown that the 24 amino acids from the N-term...

Embodiment 3

[0043] Recombinant expression of embodiment 3 RuCelB gene in escherichia coli

[0044] In order to clone the RuCelB gene sequence into the Escherichia coli expression vector pET-21a for recombinant expression, a pair of primers were designed: the forward primer added 6 His codons, skipped the signal peptide, and amplified from the 25th position of the protein, The sequence is RuCelBF:ATA GAATTC CATCATCACCATCATCACGGCAACGGCTGGGTC, reverse primer is RuCelBR:TGT AAGCTT ACCCGCCTGTCCCTG, the underlined restriction enzyme sequence. The RuCelB gene fragment was amplified by PCR reaction, and after gel recovery, it was digested with EcoRI and HindIII. After the fragment was recovered, it was ligated with the pET-21a vector that was also digested with EcoRI and HindIII, and the ligated product was transformed into E. coli Top10 strain. The obtained transformants were identified by cooking PCR using the above primers, and the enzyme activity and sequencing of the transformants contai...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biological engineering, and relates to a novel endoglucanase RuCelB, a coded gene, a preparation method and an application thereof. The RuCelB contains a 25th-336th amino acid residue sequence of SEQ ID NO.2. The preparation method is as follows: obtaining positive cloning capable of hydrolyzing sodium carboxymethylcellulose by active screening rumen microorganism metagenomic cosmid library of a yak, and further obtaining a whole-length cds sequence of the RuCelB by building subcloning, sequencing and homologous comparison; and carrying out recombined expression and obtaining the RuCelB. The specific activity of the RuCelB taking the sodium carboxymethylcellulose as a substrate is up to 158.8U / mg, and the RuCelB also has the degradability for the substrates such as filter paper, cellotriose and the like. The RuCelB can be widely applied in degradation of cellulose, comprising the industries such as cellulose biotransformation, chemical engineering, textile, food, bioenergy, feedstuff adding, pharmaceutical Industry and the like.

Description

technical field [0001] The invention belongs to the field of bioengineering, and relates to an endoglucanase and a preparation method and application thereof. The invention also relates to the recombinant plasmid and recombinant genetically engineered strain of the endoglucanase. Background technique [0002] Cellulose is the most widely distributed and abundant renewable carbon source compound on earth. However, in the plant cell wall, the microfibrils formed by the aggregation of cellulose molecules are embedded in hemicellulose and lignin to form a network structure, which makes the cellulose not easy to degrade and thus difficult to be fully transformed and utilized. The hydrolysis of cellulose molecules requires the joint action of at least three cellulase enzymes, which are endo-glucanase (ie, endo-cellulase), exo-glucanase (also known as exo-cellulose enzyme, cellobiohydrolase) and β-glucosidase. Endo-glucanase can randomly cut β-1.4-glucosidic bonds in the amorpho...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N9/46C12N15/56C12N15/63C12P19/16C12R1/645C12R1/01C12R1/685C12R1/125C12R1/84C12R1/865C12R1/19
CPCY02P20/52
Inventor吕红包蕾周峻岗袁汉英
OwnerFUDAN UNIV