Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

31 results about "Brain aneurysm" patented technology

Bulging or ballooning of the artery due to weakness in the wall of the vessel that supplies blood to the brain.

Personalized cerebral aneurysm rupture risk assessment and operation planning system

The invention discloses a personalized cerebral aneurysm rupture risk assessment and operation planning system, and relates to the technical field of cerebral aneurysm treatment. The three-dimensional reconstruction module assists a doctor in performing surgical path planning and simulation, assists the doctor in performing surgical path planning, simulates different intervention schemes and visualizes adjacent key structures, so that surgical decisions are optimized, operation risks are reduced, and the treatment success rate is improved; the risk assessment module integrates the rupture probability data and the key morphological parameters, generates a personalized risk assessment report, and provides operation intervention priority suggestions in combination with clinical guidelines so as to enhance the personalized accuracy of assessment; the operation planning simulator simulates an operation process, provides an interactive virtual environment, provides a multi-scheme comparison function, allows a doctor to test various intervention strategies in the virtual environment, and automatically generates a structured operation scheme report for direct calling of the decision support module, thereby realizing whole-process closed-loop optimization.
Owner:FIRST AFFILIATED HOSPITAL OF DALIAN MEDICAL UNIV

Systems for treating vascular disease

PCT designated stage expiredWO2025151531A3StentsProsthesisDiseaseFlow diverter
Disclosed are flow diverters including a self-expanding tubular member comprising a plurality of expandable cells having interconnected zig-zag rings and diagonal struts. The tubular member has a constrained configuration having a first outer diameter of at least 1.0 mm sized for delivery using a flow diverter delivery system and an expanded configuration having a second outer diameter larger than the first outer diameter. Related devices, delivery systems, and methods of using the devices and delivery systems for treating disease, particularly intracranial and cerebral aneurysms by deploying implantable expandable devices, are provided.
Owner:ROUTE 92 MEDICAL INC

Intelligent detection and positioning method and system for cerebral aneurysms based on multi-feature fusion

This invention provides a method and system for intelligent cerebral aneurysm detection and localization based on multi-feature fusion, relating to the field of image processing technology. The method includes receiving and preprocessing head angiography images; utilizing a multi-scale feature extraction network to obtain and fuse feature maps; constructing candidate anatomical regions using density clustering; extracting aneurysm contours using a graph cut energy function; constructing a vascular network topology map based on probabilistic feature mapping, calculating positional feature descriptors; and finally performing classification, discrimination, and annotating and displaying the detection results. By integrating multiple features, the method improves the accuracy and sensitivity of cerebral aneurysm detection and reduces the misdiagnosis rate.
Owner:BEIJING TIANTAN HOSPITAL AFFILIATED TO CAPITAL MEDICAL UNIV

A cerebral aneurysm stent deployment prediction method, device, and medium

This invention discloses a method for predicting stent deployment in cerebral aneurysms, comprising: acquiring vascular images containing cerebral aneurysms and extracting multiple vascular structures related to the aneurysm; encoding each vascular structure as a structural latent variable using a structural encoder; establishing edges based on the anatomical connections of each vascular structure using its structural latent variables as nodes to generate a structural interaction graph, and aggregating information from the structural interaction graph using a graph neural network to obtain global latent variables representing global topological relationships; extracting the geometric features of the aneurysm neck and fusing the aneurysm neck geometric features with the global latent variables; and processing the fused features using a predictive decoder to predict the location point sequence of the aneurysm stent deployment path. This embodiment improves the stability and accuracy of the prediction.
Owner:BEIJING TIANTAN HOSPITAL AFFILIATED TO CAPITAL MEDICAL UNIV

Program, information processing method, information processing device, and model generation method

Provided is a program capable of acquiring increase information related to the presence or absence of an increase in cerebral aneurysm, on the basis of a Magnetic Resonance Angiography (MRA) image of a brain. A computer acquires MRA images of the brain. If MRA images of a brain have been input, the computer inputs the acquired MRA images of the brain to a learning model that outputs increase information related to the presence or absence of an increase in cerebral aneurysm, and the computer thereby acquires increase information related to the presence or absence of an increase in a cerebral aneurysm in the input MRA images.
Owner:NAT CEREBRAL & CARDIOVASCULAR CENT

Stent and method of manufacturing the same

To provide a stent capable of accelerating the complete cure of cerebral aneurysm.SOLUTION: An aspect of the present invention is a stent 20 that is indwelled so as to be in pressure contact with a blood vessel wall and straddle a cerebral aneurysm 21, the stent 20 having a function of promoting endothelialization prior to complete occlusion of the cerebral aneurysm in a state of being in pressure contact with the blood vessel wall. The stent 20 is formed of a cylindrical braided body obtained by braiding wire rods. The wire material is obtained by coating the surface of an element wire, the element wire contains a magnesium alloy containing 90 atom% or more of Mg or pure magnesium, and the function is to promote neointima formation at the neck of the cerebral aneurysm.SELECTED DRAWING: Figure 1
Owner:NAT UNIV CORP KUMAMOTO UNIV +3

Preoperative risk prediction method for cerebral aneurysm based on multi-modal deep learning

This invention discloses a preoperative risk prediction method for cerebral aneurysms based on multimodal deep learning. To address the problems of time-consuming computational fluid dynamics simulations and difficulty in quickly obtaining individualized hemodynamic indicators, this invention reconstructs vascular geometry and a tree diagram by aligning computed tomography angiography, magnetic resonance angiography, and blood pressure and heart rate time series. It employs a graph network that satisfies Kirchhoff conservation and connects differentiable Wendt-Kessel impedance learning boundary conditions. Combining physical constraints of cardiac phase conditional neural operators, Helmholtz projection, and signed distance function boundary embedding, it approximates the flow field, calculates and closes the loop to correct wall shear stress, oscillatory shear exponent, and pressure gradient. Then, it fuses the risk features of the imaging branch, clinical branch, and text branch through expert product to output lesion-level and patient-level risks and confidence levels. This achieves the technical effect of rapidly estimating hemodynamics and performing interpretable preoperative risk assessment under physically consistent constraints.
Owner:JINHUA MUNICIPAL CENT HOSPITAL

New devices for use for treating cerebral aneurysms

The present application concerns the use of endoprothesis covalently grafted with a fucoidan for treating aneurysms, in particular cerebral aneurysms, and their process for manufacturing the same. Improved healing of cerebral aneurysms was established in vivo on a rabbit model.
Owner:INSTITUT NATIONAL DE LA SANTE & DE LA RECHERCHE MEDICALE (INSERM) - RAISON SOCIALE OBSOLÉTE +7

Brain aneurysm stent deployment prediction method, equipment and medium

The embodiment of the invention discloses a cerebral aneurysm stent deployment prediction method, which comprises the following steps: acquiring a blood vessel image containing cerebral aneurysm, and extracting a plurality of blood vessel structures related to the aneurysm from the blood vessel image; through a structure encoder, each blood vessel structure is encoded into a structure latent variable; taking the structure latent variable of each blood vessel structure as a node, establishing an edge according to the anatomical connection relationship of each blood vessel structure, generating a structure interaction diagram, and performing information aggregation on the structure interaction diagram by using a graph neural network to obtain a global latent variable for representing a global topological relationship; extracting the geometric features of the aneurysm neck of the aneurysm, and fusing the geometric features of the aneurysm neck with the global latent variables; and processing the fused features by using a prediction decoder, and predicting a position point sequence of an aneurysm stent deployment path. According to the embodiment, the prediction stability and accuracy are improved.
Owner:BEIJING TIANTAN HOSPITAL AFFILIATED TO CAPITAL MEDICAL UNIV

Brain aneurysm identifying and positioning method based on vascular section defect detection

The invention discloses a cerebral aneurysm recognition and positioning method based on vascular section defect detection, and aims to search for the maximum inscribed circle of a vascular section by segmenting a vascular section sequence. The normal vascular section is closer to the incircle, and the abnormal aneurysm shows local protrusion, so that the abnormal aneurysm is identified and positioned by taking the abnormal aneurysm as a feature. TOF-MRA images are generally adopted for aneurysm recognition, and relatively pure blood vessel parts need to be obtained through segmentation firstly, so that the method sequentially utilizes binarization threshold segmentation, connected domain filtering and retrograde blood vessel segmentation, then blood vessel surface point cloud is extracted, blood vessel slice sequences are obtained based on point cloud traversal segmentation, and finally maximum inscribed circles of all the sequences are searched. When the area of the vascular section and the maximum inscribed circle exceeds a certain threshold value, the aneurysm appears. Based on the original TOF-MRA image of the brain, the brain aneurysm can be quickly and accurately identified and positioned, and the accuracy rate reaches 86%. A scientific and effective means is provided for early screening of cerebral artery risks of the patient, and timely intervention is facilitated to guarantee the health of the patient.
Owner:NANJING FIRST HOSPITAL

Methods of detecting and treating cerebral aneurysms

The present disclosure provides a whole blood, protein-based diagnostic test for presence of unruptured aneurysms and allow for tracking progression of unruptured, ruptured, and previously treated aneurysms to guide clinical decision making. Further, the present disclosure relates to methods of treating aneurysms.
Owner:UNIV OF PITTSBURGH OF THE COMMONWEALTH SYST OF HIGHER EDUCATION +1

Cerebral aneurysm intervention path planning system and method based on space-time diagram convolutional network

The invention relates to the field of medical image processing and computer-aided interventional operations, in particular to a cerebral aneurysm interventional path planning system and method based on a space-time diagram convolutional network. DSA image data are received and processed through an image processing module, a cerebrovascular network diagram is constructed, and an aneurysm point is marked as an end point; the spatial-temporal feature extraction module extracts node and edge features in the cerebrovascular network diagram, the dynamic weight updating module updates the dynamic weight of the cerebrovascular network diagram in real time, and the path decision-making module generates a decision-making path of microcatheter movement based on a deep reinforcement learning algorithm and calculates a path reward value. The execution control module controls the microcatheter to move according to a decision path, monitors the position of the microcatheter and the brain blood vessel state and feeds back real-time state information to the path decision module, compared with a traditional static planning method, the dynamic characteristics of the blood vessel can be captured in real time, dynamic adjustment of the path is achieved, the navigation success rate is increased to 95% or above from about 70%, and the navigation efficiency is improved. The performance is particularly obvious in complex and deformed blood vessels.
Owner:XINXIANG CENTER HOSPITAL

Electrophysiological monitoring system and method for guiding temporary occlusion duration in cerebral aneurysm operation

PendingCN121154182AHealth-index calculationSensorsTemporary occlusionElectro physiology
The invention relates to the field of cerebral aneurysm, in particular to an electrophysiology monitoring system and method for guiding temporary blocking duration in cerebral aneurysm operation, the electrophysiology monitoring system comprises WR and PR, the WR and PR are calculated according to time T1, time T2 and time T3, WR = (T2 / T1) * 100%, PR = [T3 / (T1 + T2)] * 100%; when WRlt; 100% and PRlt; when the concentration is 100%, the operation is selected to be continued; when WR is greater than or equal to 100%, the subsequent blocking duration is less than or equal to 80% of the current T1; when PR > = 100%, the procedure is marked as "high recovery delay" and the post-operative intervention is prepared. According to the method, the time T1, the time T2 and the time T3 are recorded and used for calculating the WR and PR indexes, and the early warning ratio and the prediction ratio are quantitatively calculated to guide the intra-operative decision, so that errors caused by experience misjudgment of a user are avoided, and the standardization and the accuracy of operation are improved.
Owner:CHANGZHOU NO 2 PEOPLES HOSPITAL

Method and system for detecting cerebral aneurysms using artificial intelligence using 3D angiographic Computed Tomography

ActiveKR102992962B1Patient modelInformation processing
An artificial intelligence cerebral aneurysm detection system using 3D angiographic CT according to one embodiment of the present invention comprises: an input unit for acquiring a CT image of a patient; and an information processing unit including a patch model operating processor for operating a patch model that predicts the location of a cerebral infarction on a patch basis, and a patient model operating processor for operating a patient model that predicts the presence or absence of a cerebral aneurysm on a patient basis based on the results of the patch model. By doing so, the presence or absence of a cerebral aneurysm in a patient can be determined, thereby contributing to the improvement of the accuracy of cerebral aneurysm diagnosis.
Owner:PURPLE A EYE CO LTD

Implant with increased braid density and method of making

PCT designated stageWO2025226728A1DiagnosticsOcculdersBrain aneurysmBiomedical engineering
An implant comprises a braided body configured for placement within a cerebral aneurysm and having a longitudinal axis, the braided body comprising a proximal face, at least an inner portion of the proximal face twisted around the longitudinal axis.
Owner:GALAXY THERAPEUTICS INC

Kit for detecting degree of methylation of mta1 associated with cerebral aneurysm and application thereof

The application discloses a kit for detecting the degree of methylation of a gene related to cerebral aneurysm MTA1 and application thereof, characterized in that the kit comprises a pair of MTA1 gene DNA methylation-specific amplification primers and a gene DNA methylation-specific sequencing primer in the kit. MTA1 The specific amplification upstream primer has SEQ ID NO. 1, the specific amplification downstream primer has SEQ ID NO. 2, and the methylation-specific sequencing primer has SEQ ID NO. 3. MTA1 The region of the gene DNA detected by the sequence is a specific position at the front end of the gene, and the DNA methylation level is analyzed by a pyrosequencing technology. MTA1 The gene DNA methylation level is negatively correlated with the incidence of cerebral aneurysm; and the diagnostic kit can conveniently and quickly realize detection of cerebral aneurysm at a molecular level, has high detection efficiency and strong pertinence.
Owner:NINGBO FIRST HOSPITAL

System and method for assessing intracranial aneurysms

Aspects of the present invention relate to a method for assessing cerebral aneurysms comprising the steps of collecting imaging and blood flow data of an aneurysm and the attached arteries in a subject, creating a 3D model of the aneurysm and the attached arteries from the imaging data, generating blood flow simulations with the 3D model and the blood flow data, extracting one or more parameters from the simulations, processing the one or more parameters to generate one or more stress indices, calculating a risk assessment score for the subject based on a statistical analysis of the one or more parameters and the one or more stress indices.
Owner:NEW YORK UNIV

TPU substrate forming an embolization device for treating defect vascular vessel

PCT designated stageWO2025234978A1StentsOcculdersBlood flowBrain aneurysm
The present invention compromises a cerebral aneurysm device designed for insertion in various cerebral aneurysm types and block blood flow into a cerebral aneurysm to prevent it from rupturing.
Owner:DINHTEC INC

Apparatus and method for analyzing brain image

PCT designated stageWO2026089196A1CatheterSensorsImaging brainRadiology
Disclosed are an apparatus and method for analyzing a brain image. The present invention trains an artificial intelligence model with an MRA brain image that is easily captured and a DSA brain image effective for detecting a brain aneurysm to output information about the brain aneurysm, and when the training of the artificial intelligence model is completed, inputs the MRA brain image to the artificial intelligence model to output brain aneurysm information, thereby exhibiting an effect of detecting a brain aneurysm by using an MRA brain image with substantially the same accuracy as when detecting a brain aneurysm with a DSA brain image.
Owner:NEUROPHET INC

Electrophysiology monitoring system and method for predicting cerebral aneurysm postoperative muscle strength index

The invention relates to the field of cerebral aneurysm, in particular to an electrophysiology monitoring system and method for predicting cerebral aneurysm postoperative muscle strength indexes, the electrophysiology monitoring system comprises WR and PR, the WR and PR are calculated according to time T1, time T2 and time T3, WR = (T2 / T1) * 100%, PR = [T3 / (T1 + T2)] * 100%; when PR is greater than or equal to 100%, the delay flag is recovered; and when WR is greater than or equal to 100%, short-term muscle strength decrease prediction is represented. The time T1, the time T2 and the time T3 are recorded and are used for calculating WR and PR indexes, so that the postoperative recovery condition of a patient is predicted, a postoperative recovery scheme is quickly formulated, the waiting time is saved, and a personalized recovery scheme can be formulated according to actual indexes.
Owner:CHANGZHOU NO 2 PEOPLES HOSPITAL

Method for preparing filling material for cerebral aneurysm embolization, and use thereof

PCT designated stageWO2026116525A1SurgeryX-ray constrast preparationsBrain aneurysmReoperative surgery
The present invention relates to a method for preparing a filling material for cerebral aneurysm embolization, and use thereof. The filling material for cerebral aneurysm embolization, prepared according to the preparation method of the present invention, and thus can contribute to increasing the success rate of embolization and improving the safety of surgery, thereby being suitable for use in actual cerebral aneurysm embolization procedures.
Owner:POSTECH ACADEMY INDUSTRY FOUNDATION +1

Computer simulator for treatment planning of cerebral aneurysms

PendingJP2026005298AComputer-aided planning/modelling3d imageBrain aneurysm
A computer simulator for use in selecting a device 14 and planning a treatment for a brain aneurysm 12.SOLUTION: With device 14 inserted in cerebral aneurysm 12, the three dimensional image is equally divided by a cutting plane 18 perpendicular to a centerline 16 of cerebral aneurysm 12 or device 14. The positional relation between the outer peripheral surface of the device 14 and the inner wall of the cerebral aneurysm 12 or the degree of a gap generated between them is obtained for each divided part. The result is colored and displayed on the three dimensional image of the cerebral aneurysm 12. The length in the direction along the center line of the device in the cerebral aneurysm is calculated, and an image of the device actually inserted into the cerebral aneurysm is drawn.SELECTED DRAWING: Figure 1
Owner:株式会社アイブイラボ

TPU substrate forming an embolization device for treating defect vascular vessel

PendingUS20250339152A1OcculdersBlood flowBrain aneurysm
The present invention compromises a cerebral aneurysm device designed for insertion in various cerebral aneurysm types and block blood flow into a cerebral aneurysm to prevent it from rupturing.
Owner:DINHTEC INC

CHPT1 gene methylation detection kit for assisting in diagnosing or detecting cerebral aneurysm

PendingCN122104895AMicrobiological testing/measurementDNA/RNA fragmentationBrain aneurysmCranial aneurysm
The application discloses a kit for assisting in diagnosing or detecting a cerebral aneurysm CHPT1 The kit is characterized in that the kit comprises reagents for detecting CHPT1 a target sequence in a gene promoter region, CHPT1 the target sequence in the gene promoter region is shown as SEQ ID NO. 2: CGGCAGCCGGGCAGGCCGGCCTGACCTCGACCTCCGCCGTGCGGGCCCGACCGGTGAGTCCAGCCCGGCAGTCGCAGGACCCGGCCG, and the reagents comprise CHPT1 a methylation-specific amplification upstream primer, a methylation-specific amplification downstream primer and CHPT1 a methylation-specific sequencing primer, and further comprise CHPT1 RT-qPCR quantitative amplification primers for a transcriptome, so that the intracranial aneurysm can be detected at a molecular level in a convenient and fast manner, and the detection efficiency is high and the detection is targeted.
Owner:NINGBO FIRST HOSPITAL

Stent and manufacturing method therefor

PCT designated stageWO2026029206A1StentsPharmaceutical containersWire rodMg alloys
Provided is a stent with which the complete recovery of a cerebral aneurysm can be accelerated. One aspect of the present invention is a stent 20 that is placed so as to be compression-bonded to a blood vessel wall and straddle a cerebral aneurysm 21, and has the function of promoting endothelialization prior to the complete occlusion of the cerebral aneurysm in a state of being compression-bonded to the blood vessel wall. This stent 20 is composed of a cylindrical braided body braided with a wire rod. The wire rod is obtained by coating the surface of an element wire, the element wire contains a magnesium alloy containing at least 90 at% of Mg, or pure magnesium, and the function is to promote neointimal formation on the neck of the cerebral aneurysm.
Owner:NAT UNIV CORP KUMAMOTO UNIV +2

Medical device and method

PCT designated stageWO2025229329A1StentsBlood vesselsFlow diverterArtery aneurysm
The invention relates to an apparatus for the treatment of a bifurcation aneurysm. The apparatus comprises two embodiments. In the first embodiment, a first tubular stent has a first portion that sits in the major artery and a second portion that sits in the first branch artery. A second tubular stent slides within the first stent and passes through an aperture in the first stent, so a portion of the second stent sits within the second branch artery. This forms a Y-shaped flow diverter which relieves pressure on the cerebral aneurysm. In the second embodiment, a singular stent has a first portion that resides within the major artery and a second portion that resides in the first branch artery. It has an aperture that extends towards the second branch artery that occludes the aneurysm. This forms a Y- or T-shaped flow diverter which relieves pressure on the cerebral aneurysm.
Owner:STOCKCROSS CONSULTING LTD

Ticagrelor IV for use in the prevention of thromboembolic events

PendingKR1020260113052ATicagrelorArterial procedure
The present invention provides a pharmaceutical composition containing ticagrelor for use in reducing or preventing thromboembolic events before and / or during and / or after neurovascular arterial procedures in a patient requiring the use of the pharmaceutical composition containing ticagrelor, comprising administering an effective amount of the pharmaceutical composition containing ticagrelor to a patient, wherein the pharmaceutical composition is an aqueous solution containing a solubilizing agent for ticagrelor and the pharmaceutical composition is administered intravenously; wherein the patient suffers from a cerebral aneurysm, cerebral arteriosclerosis, cervical arteriosclerosis, neurovascular carotid dissection or carotid dissection.
Owner:HYLORIS DEV SA