20 results about "Brain aneurysm" patented technology

The invention discloses a personalized cerebral aneurysm rupture risk assessment and operation planning system, and relates to the technical field of cerebral aneurysm treatment. The three-dimensional reconstruction module assists a doctor in performing surgical path planning and simulation, assists the doctor in performing surgical path planning, simulates different intervention schemes and visualizes adjacent key structures, so that surgical decisions are optimized, operation risks are reduced, and the treatment success rate is improved; the risk assessment module integrates the rupture probability data and the key morphological parameters, generates a personalized risk assessment report, and provides operation intervention priority suggestions in combination with clinical guidelines so as to enhance the personalized accuracy of assessment; the operation planning simulator simulates an operation process, provides an interactive virtual environment, provides a multi-scheme comparison function, allows a doctor to test various intervention strategies in the virtual environment, and automatically generates a structured operation scheme report for direct calling of the decision support module, thereby realizing whole-process closed-loop optimization.

Devices and methods for treatment of a patient's vasculature including occluding aneurysms and blood vessels are described. The device includes a self-expanding resilient permeable shell having a radially constrained state and an expanded state with an axially shortened configuration. The permeable shell may be a single layer of braided elongate filaments having first and second ends that are secured at the proximal end of the permeable shell. The devices may also include permeable shells made of woven braided mesh having a variable mesh density, i.e., the average size of pores in one region are a different than the average size of pores in another region. Devices and methods of using the device to treat a cerebral aneurysm are also described.

This invention discloses a method for predicting stent deployment in cerebral aneurysms, comprising: acquiring vascular images containing cerebral aneurysms and extracting multiple vascular structures related to the aneurysm; encoding each vascular structure as a structural latent variable using a structural encoder; establishing edges based on the anatomical connections of each vascular structure using its structural latent variables as nodes to generate a structural interaction graph, and aggregating information from the structural interaction graph using a graph neural network to obtain global latent variables representing global topological relationships; extracting the geometric features of the aneurysm neck and fusing the aneurysm neck geometric features with the global latent variables; and processing the fused features using a predictive decoder to predict the location point sequence of the aneurysm stent deployment path. This embodiment improves the stability and accuracy of the prediction.

Provided is a program capable of acquiring increase information related to the presence or absence of an increase in cerebral aneurysm, on the basis of a Magnetic Resonance Angiography (MRA) image of a brain. A computer acquires MRA images of the brain. If MRA images of a brain have been input, the computer inputs the acquired MRA images of the brain to a learning model that outputs increase information related to the presence or absence of an increase in cerebral aneurysm, and the computer thereby acquires increase information related to the presence or absence of an increase in a cerebral aneurysm in the input MRA images.

To provide a stent capable of accelerating the complete cure of cerebral aneurysm.SOLUTION: An aspect of the present invention is a stent 20 that is indwelled so as to be in pressure contact with a blood vessel wall and straddle a cerebral aneurysm 21, the stent 20 having a function of promoting endothelialization prior to complete occlusion of the cerebral aneurysm in a state of being in pressure contact with the blood vessel wall. The stent 20 is formed of a cylindrical braided body obtained by braiding wire rods. The wire material is obtained by coating the surface of an element wire, the element wire contains a magnesium alloy containing 90 atom% or more of Mg or pure magnesium, and the function is to promote neointima formation at the neck of the cerebral aneurysm.SELECTED DRAWING: Figure 1

This invention discloses a preoperative risk prediction method for cerebral aneurysms based on multimodal deep learning. To address the problems of time-consuming computational fluid dynamics simulations and difficulty in quickly obtaining individualized hemodynamic indicators, this invention reconstructs vascular geometry and a tree diagram by aligning computed tomography angiography, magnetic resonance angiography, and blood pressure and heart rate time series. It employs a graph network that satisfies Kirchhoff conservation and connects differentiable Wendt-Kessel impedance learning boundary conditions. Combining physical constraints of cardiac phase conditional neural operators, Helmholtz projection, and signed distance function boundary embedding, it approximates the flow field, calculates and closes the loop to correct wall shear stress, oscillatory shear exponent, and pressure gradient. Then, it fuses the risk features of the imaging branch, clinical branch, and text branch through expert product to output lesion-level and patient-level risks and confidence levels. This achieves the technical effect of rapidly estimating hemodynamics and performing interpretable preoperative risk assessment under physically consistent constraints.

The embodiment of the invention discloses a cerebral aneurysm stent deployment prediction method, which comprises the following steps: acquiring a blood vessel image containing cerebral aneurysm, and extracting a plurality of blood vessel structures related to the aneurysm from the blood vessel image; through a structure encoder, each blood vessel structure is encoded into a structure latent variable; taking the structure latent variable of each blood vessel structure as a node, establishing an edge according to the anatomical connection relationship of each blood vessel structure, generating a structure interaction diagram, and performing information aggregation on the structure interaction diagram by using a graph neural network to obtain a global latent variable for representing a global topological relationship; extracting the geometric features of the aneurysm neck of the aneurysm, and fusing the geometric features of the aneurysm neck with the global latent variables; and processing the fused features by using a prediction decoder, and predicting a position point sequence of an aneurysm stent deployment path. According to the embodiment, the prediction stability and accuracy are improved.

The present disclosure provides a whole blood, protein-based diagnostic test for presence of unruptured aneurysms and allow for tracking progression of unruptured, ruptured, and previously treated aneurysms to guide clinical decision making. Further, the present disclosure relates to methods of treating aneurysms.

The invention relates to the field of cerebral aneurysm, in particular to an electrophysiology monitoring system and method for guiding temporary blocking duration in cerebral aneurysm operation, the electrophysiology monitoring system comprises WR and PR, the WR and PR are calculated according to time T1, time T2 and time T3, WR = (T2 / T1) * 100%, PR = [T3 / (T1 + T2)] * 100%; when WRlt; 100% and PRlt; when the concentration is 100%, the operation is selected to be continued; when WR is greater than or equal to 100%, the subsequent blocking duration is less than or equal to 80% of the current T1; when PR > = 100%, the procedure is marked as "high recovery delay" and the post-operative intervention is prepared. According to the method, the time T1, the time T2 and the time T3 are recorded and used for calculating the WR and PR indexes, and the early warning ratio and the prediction ratio are quantitatively calculated to guide the intra-operative decision, so that errors caused by experience misjudgment of a user are avoided, and the standardization and the accuracy of operation are improved.

An artificial intelligence cerebral aneurysm detection system using 3D angiographic CT according to one embodiment of the present invention comprises: an input unit for acquiring a CT image of a patient; and an information processing unit including a patch model operating processor for operating a patch model that predicts the location of a cerebral infarction on a patch basis, and a patient model operating processor for operating a patient model that predicts the presence or absence of a cerebral aneurysm on a patient basis based on the results of the patch model. By doing so, the presence or absence of a cerebral aneurysm in a patient can be determined, thereby contributing to the improvement of the accuracy of cerebral aneurysm diagnosis.

Provided are methods of treating a cerebral cavernous malformation (CCM) and methods of treating cerebral aneurysm in a mammal with certain rho kinase inhibitors.

The application discloses a kit for detecting the degree of methylation of a gene related to cerebral aneurysm MTA1 and application thereof, characterized in that the kit comprises a pair of MTA1 gene DNA methylation-specific amplification primers and a gene DNA methylation-specific sequencing primer in the kit. MTA1 The specific amplification upstream primer has SEQ ID NO. 1, the specific amplification downstream primer has SEQ ID NO. 2, and the methylation-specific sequencing primer has SEQ ID NO. 3. MTA1 The region of the gene DNA detected by the sequence is a specific position at the front end of the gene, and the DNA methylation level is analyzed by a pyrosequencing technology. MTA1 The gene DNA methylation level is negatively correlated with the incidence of cerebral aneurysm; and the diagnostic kit can conveniently and quickly realize detection of cerebral aneurysm at a molecular level, has high detection efficiency and strong pertinence.

Aspects of the present invention relate to a method for assessing cerebral aneurysms comprising the steps of collecting imaging and blood flow data of an aneurysm and the attached arteries in a subject, creating a 3D model of the aneurysm and the attached arteries from the imaging data, generating blood flow simulations with the 3D model and the blood flow data, extracting one or more parameters from the simulations, processing the one or more parameters to generate one or more stress indices, calculating a risk assessment score for the subject based on a statistical analysis of the one or more parameters and the one or more stress indices.

Disclosed are an apparatus and method for analyzing a brain image. The present invention trains an artificial intelligence model with an MRA brain image that is easily captured and a DSA brain image effective for detecting a brain aneurysm to output information about the brain aneurysm, and when the training of the artificial intelligence model is completed, inputs the MRA brain image to the artificial intelligence model to output brain aneurysm information, thereby exhibiting an effect of detecting a brain aneurysm by using an MRA brain image with substantially the same accuracy as when detecting a brain aneurysm with a DSA brain image.

The present invention relates to a method for preparing a filling material for cerebral aneurysm embolization, and use thereof. The filling material for cerebral aneurysm embolization, prepared according to the preparation method of the present invention, and thus can contribute to increasing the success rate of embolization and improving the safety of surgery, thereby being suitable for use in actual cerebral aneurysm embolization procedures.

A computer simulator for use in selecting a device 14 and planning a treatment for a brain aneurysm 12.SOLUTION: With device 14 inserted in cerebral aneurysm 12, the three dimensional image is equally divided by a cutting plane 18 perpendicular to a centerline 16 of cerebral aneurysm 12 or device 14. The positional relation between the outer peripheral surface of the device 14 and the inner wall of the cerebral aneurysm 12 or the degree of a gap generated between them is obtained for each divided part. The result is colored and displayed on the three dimensional image of the cerebral aneurysm 12. The length in the direction along the center line of the device in the cerebral aneurysm is calculated, and an image of the device actually inserted into the cerebral aneurysm is drawn.SELECTED DRAWING: Figure 1

The application discloses a kit for assisting in diagnosing or detecting a cerebral aneurysm CHPT1 The kit is characterized in that the kit comprises reagents for detecting CHPT1 a target sequence in a gene promoter region, CHPT1 the target sequence in the gene promoter region is shown as SEQ ID NO. 2: CGGCAGCCGGGCAGGCCGGCCTGACCTCGACCTCCGCCGTGCGGGCCCGACCGGTGAGTCCAGCCCGGCAGTCGCAGGACCCGGCCG, and the reagents comprise CHPT1 a methylation-specific amplification upstream primer, a methylation-specific amplification downstream primer and CHPT1 a methylation-specific sequencing primer, and further comprise CHPT1 RT-qPCR quantitative amplification primers for a transcriptome, so that the intracranial aneurysm can be detected at a molecular level in a convenient and fast manner, and the detection efficiency is high and the detection is targeted.

Provided is a stent with which the complete recovery of a cerebral aneurysm can be accelerated. One aspect of the present invention is a stent 20 that is placed so as to be compression-bonded to a blood vessel wall and straddle a cerebral aneurysm 21, and has the function of promoting endothelialization prior to the complete occlusion of the cerebral aneurysm in a state of being compression-bonded to the blood vessel wall. This stent 20 is composed of a cylindrical braided body braided with a wire rod. The wire rod is obtained by coating the surface of an element wire, the element wire contains a magnesium alloy containing at least 90 at% of Mg, or pure magnesium, and the function is to promote neointimal formation on the neck of the cerebral aneurysm.

The present invention provides a pharmaceutical composition containing ticagrelor for use in reducing or preventing thromboembolic events before and / or during and / or after neurovascular arterial procedures in a patient requiring the use of the pharmaceutical composition containing ticagrelor, comprising administering an effective amount of the pharmaceutical composition containing ticagrelor to a patient, wherein the pharmaceutical composition is an aqueous solution containing a solubilizing agent for ticagrelor and the pharmaceutical composition is administered intravenously; wherein the patient suffers from a cerebral aneurysm, cerebral arteriosclerosis, cervical arteriosclerosis, neurovascular carotid dissection or carotid dissection.

This invention discloses a biomarker combination and its screening method, relating to the field of biotechnology. The biomarker combination includes lactate, glutamine, arginine, and 3-methylpentenoic acid, applied to assess the rupture risk of cerebral aneurysms. The screening method for the biomarker combination involves: collecting metabolic fingerprints from serum of patients with cerebral aneurysms and healthy controls using nanoparticle-enhanced laser desorption / ionization mass spectrometry; and performing machine learning to screen the biomarker combination. This invention utilizes nanoparticle-enhanced laser desorption / ionization mass spectrometry to screen lactate, glutamine, arginine, and 3-methylpentenoic acid as metabolic biomarkers, and uses these biomarkers to assess the rupture risk of cerebral aneurysms. Significant differences were observed between the low-risk and high-risk groups (P < 0.05).