43results about How to "Poor efficacy" patented technology

The present invention provides novel insecticidal formulations comprising an effective concentration of: 1) at least one or more essential oils and an insecticidal soap; 2) at least one or more essential oils, an insecticidal soap, and pyrethrins; 3) at least one or more essential oils and pyrethrins; 4) at least one or more essential oils, an insecticidal soap and a synergist, such as sodium lauryl sulfate, sodium dodecyl sulfate or lecithin; 5) at least one or more essential oils, an insecticidal soap, a synergist, and pyrethrins; and 6) at least one or more essential oils, a synergist, and pyrethrins. A carrier oil, such as mineral oil, may be added to any of the foregoing formulations.

A method of detecting DNA markers in the 12q22-23 region. The method comprises providing a sample containing acellular DNA from a subject and detecting one or more DNA markers in the 12q22-23 region in the sample. Also disclosed are methods of diagnosing and monitoring cancer; methods of determining the efficacy of a therapy, and the probabilities of survival and responsiveness to a therapy; and packaged products for using these methods.

The invention relates to an inspirator and an atomization component thereof. The atomization component comprises a casing, an atomization element and a switching valve. An atomization chamber, a liquid guide channel and a liquid storage chamber for storing liquids are formed in the casing. The atomization chamber is communicated with the liquid guide channel which is communicated with the liquid storage chamber. The atomization element is arranged in the atomization chamber and is used for atomizing liquids. At least part of the switching valve is arranged in the liquid guide channel and is used for controlling on or off of the liquid guide channel. By means of the inspirator and the atomization component thereof, the switching valve is arranged in the liquid guide channel between the atomization chamber and the liquid storage chamber, and on or off of the liquid guide channel is controlled through the switching valve. When the inspirator is not used, the switching valve cuts off the liquid guide channel, the atomization chamber and the liquid storage chamber are sealed relatively, and accordingly, liquids in the liquid storage chamber are volatilized through the atomization element, and the taste of electronic cigarettes and the medical atomization inspirator effect cannot get worse for being put for a long time.

The present invention is directed to pharmaceutical agents and compositions useful for the treatment and prevention of amyloid disease in a subject. The invention further relates to isolated antibodies that recognize a common conformational epitope of amyloidogenic proteins or peptides that are useful for the diagnosis, treatment, and prevention of amyloid disease.

The system for treating a region of the epidermis, comprising: —at least one laser energy source; —a time control device to generate a laser beam; —a laser energy focusing system arranged and produced to direct a laser beam on said region of the epidermis. The control device generates a laser beam comprising a plurality of composite pulses, emitted at a base frequency, each composite pulse comprising a sequence of sub-pulses at a higher frequency than said base frequency.

The present invention is directed to polymerized products and compositions useful for the treatment and prevention of amyloid disease in a subject. The invention further relates to isolated antibodies that recognize a common conformational epitope of amyloidogenic proteins or peptides that are useful for the diagnosis, treatment, and prevention of amyloid disease.

This invention provides an external use medincet for treating chronic rhinitis and nasosinusitis. It is prepared by using the following Chinese medical ingredients according to their weight ratio: American ginseng 15-3, peony root bark 12-5,Chinese angelica root 12-5,towelgourd vascular bundles 10-5,balloon-flower 10-5,puncturevine caltrap fruit 10-5, coptis rhizome0-5,membranous milkvetch root 10-5,ginseng 10-5,sevenlobed yam rhizome 8-5,pumice8-5,fructus forsythiae 8-5,Dahurian angelica root 5-1,biond magnolia flower-bud 5-1,skebia stem 5-1,siberian cocklebur fruit 5-1,cassiabarktree bark 3-1,manchurian whildginger herb 3-1.In the aspect of the medical application, it is convenient and easy to use with light side effects, no irritatations to the skin and obvious curative effects. According to statistics that the total effective ratio for treating chronic rhinitis, chronic nasosinusitis is above 95%.

The present invention relates to a marker piRNA-54265 and a method in diagnosis, treatment, and prognostic evaluation of colorectal cancer. The marker piRNA-54265 is capable of being used for diagnosing and / or treating colorectal cancer, wherein the marker piRNA-54265 is selected from any of molecules as follows: (1) SEQ ID NO.29: tggaggtgatgaactgtctgagcctgacc; (2) SEQ ID NO.30: UGGAGGUGAUGAACUGUCUGAGCCUGACC; (3) SEQ ID NO.31: GGUCAGGCUCAGACAGUUCAUCACCUCCA; (4) a piR-54265 variant and a piR-54265 derivative modified from the molecule shown in (1), (2) or (3) with a same function; (5) a piR-54265 polynucleotide construct capable of down-regulating an amount of the piR-54265 in vivo after being introduced; and (6) an expression vector containing the polynucleotide construct of (5). The method is used for diagnosing / screening colorectal cancer, evaluating chemosensitivity of a colorectal cancer patient, evaluating a prognosis of a colorectal cancer patient or treating colorectal cancer.

The invention discloses a traditional Chinese medicine preparation for treating synovitis, which is prepared for promoting blood circulation by removing blood stasis, relieving inflammation and pains, eliminating blood stasis and promoting tissue regeneration, on the basis of overview of traditional Chinese medicine on synovitis diseases and of modern medicine to pathogenesis and treatment principle. The preparation uses the following pure natural Chinese herbal medicine: pseudo-ginseng, safflower, gardenia, mastix, myrrh, rhubarb, pearl, nutgall and calculus bovis, which are combined according to the theory of traditional Chinese medicine and concocted respectively. The preparation has the advantages of quick medical effect, quick disappearance of clinical symptoms, small toxic and side effects, short treatment course, little pain, low cost and high primary healing rate, and can relieve the pain of a synovitis patient quickly.

The invention provides application of ailanthone (AIL) which is shown in a formula (I) and is a monomer of Chinese traditional herbs to preparation of medicines for treating prostatic disease. By a compound, in-vitro and / or in-vivo growth and migration of prostate carcinoma cells can be suppressed obviously, protein expression level of an androgen receptor in the prostate carcinoma cells is reduced, and a signal path of the androgen receptor is suppressed. The compound has a prostate cancer treatment application prospect.

The invention relates to an inspirator and an atomization component thereof. The atomization component comprises a casing, an atomization element and a switching valve. An atomization chamber, a liquid guide channel and a liquid storage chamber for storing liquids are formed in the casing. The atomization chamber is communicated with the liquid guide channel which is communicated with the liquid storage chamber. The atomization element is arranged in the atomization chamber and is used for atomizing liquids. At least part of the switching valve is arranged in the liquid guide channel and is used for controlling on or off of the liquid guide channel. By means of the inspirator and the atomization component thereof, the switching valve is arranged in the liquid guide channel between the atomization chamber and the liquid storage chamber, and on or off of the liquid guide channel is controlled through the switching valve. When the inspirator is not used, the switching valve cuts off the liquid guide channel, the atomization chamber and the liquid storage chamber are sealed relatively, and accordingly, liquids in the liquid storage chamber are volatilized through the atomization element, and the taste of electronic cigarettes and the medical atomization inspirator effect cannot get worse for being put for a long time.

The invention discloses a Chinese patent drug for treating toothache, which contains the following material medicines by weight proportions: 3-10 portions of beam root, 25-35 portions of gypsum, 5-15 portions of corn mint, and 5-15 portions of lesser galangal. During production, the gypsum is grinded into powder, then the beam root, the corn mint, and the lesser galangal are mixed and grinded into powder, and then the powders are mixed evenly for making pulvis, then the pulvis is enclosed into a filter paper bag. The medicament disclosed by the invention is lesser but better, can treat the symptoms and root of the disease simultaneously, is applicable for the sufferers with gingivitis, pulpitis, parodontitis, pericoronitis, tip pericoronitis, and other dental disease. The cure rate reaches 93.2 percent, and the total effectivity reaches 98.4 percent. The medicine directly acts on the afflicted part of toothache by external rinse in mouth, the cure on common sufferer can take effect exactly on the same day, the sufferer can be healed within two weeks, dispensing with hospitalization. The usage of the medicine is safer without harmful side effect. So that the patient suffers less pain, with less cost, and can accept the Chinese patent drug easier.

The invention relates to an orally-taken traditional Chinese drug for treating psoriasis vulgaris, and belongs to the technical field of a traditional Chinese drug composition. The present invention provides an orally-taken traditional Chinese drug for radically curing psoriasis vulgaris, wherein the orally-taken traditional Chinese drug has a significant treatment effect. The orally-taken traditional Chinese drug of the present invention comprises the following components (by weight), 10-30 g of deinagkistrodon, 10-30 g of diverse wormwood herb, 5-25 g of sessile stemona root tuber, 10-30 g of dictamni cortex, 10-30 g of tonkin sophora root, 10-30 g of Chinese clematis root and rhizome, 5-15 g of incised notopterygium rhizome and root, 10-30 g of paniculate swallowwort root, 20-40 g of antelope horn, 50-70 g of glabrous greenbrier rhizome, 10-30 g of appendiculate cremastra pseudobulb, 20-40 g of prepared rhizome of rehmannia, 20-40 g of caulis lonicerae, 5-15 g of tamarix chinensis, 20-40 g of oldenlandia, 5-15 g of silkworm faeces, and 10-30 g of hawksbill.

Engineered Influenza polynucleotides, viruses, vaccines, and methods of making and using the same are provided. More specifically, the present inventors have developed replication competent engineered influenza viruses having, for example, a modified segment 4 and / or segment 6 that include at least one additional polynucleotide encoding a heterologous polypeptide.

The invention relates to a preparation process modified black ginseng for nutritional diversity. The preparation process is characterized by comprising the steps of: extracting concentrates of pseudo-ginseng, salvia miltiorrhiza, radix puerariae, radix ophiopogonis, mulberry and other herbs, extracting concentrates of gynostemma pentaphylla, ginseng leaves and the like, mixing the two types of concentrates to prepare comprehensive mixturemixed solution, soaking suncured ginseng in the mixed solution for 48 hours, performing freezing and melting three times respectively to inhibit and stabilize the mild performance, and finally performing freeze-drying, sterilization and packaging to obtain the modified black ginseng product.

The invention relates to the field of immunotherapy, in particular to a kit for predicting the curative effect of an immune checkpoint inhibitor on a cancer patient. The kit for predicting the curative effect of the immune checkpoint inhibitor on the cancer patient comprises a reagent for detecting the expression level of laminin-gamma2, and the amino acid sequence of laminin-gamma2 is shown as SEQ ID No.1. According to the invention, a new and more effective clinical marker laminin Lamin gamma2 is found to predict the curative effect of the immune checkpoint inhibitor on cancer patients, so that the cure rate of the patients is improved. Meanwhile, animal experiments find that the curative effect of the PD1 antibody can be improved by inhibiting a TGF-beta1 signal to reduce the expressionof the Laminin-gamma2.

The invention provides a medicine for treating hemorrhagic apoplexy. The medicine for treating the hemorrhagic apoplexy is obtained by screening thyme herb, herba chelidonii, radix rhodomyrti, creeping dichondra herb, Chinese wolfberry fruit, adhatoda ventricosa, rhizoma polygonati, radix moridae officinalls, sweet wormwood herb, airpotato yam rhizomes and the like from a large quantity of Chinese herbal medicine ingredients and optimizing the using amount and combination. On the basis, it makes clear that the medicine has the exact treatment effect on the hemorrhagic apoplexy through an experimental means, and it is proved that neurological deficits and deterioration can be reduced by inhibiting immune cells from entering the brain in the acute period, and the effect is achieved in the mode that by inhibiting the regulating, controlling and maintaining functions of encephalic immune cells on an inflammation environment, inflammations are inhibited, and secondary pathological damage of the inflammations in the acute period is reduced. According to the medicine, the superior technical effect is achieved through the innovative technical means, the cost is low, and achievement is easy, so that the good application prospect is achieved.

The present invention provides for compositions and methods for the treatment of Parkinson's disease comprising a compound of formula (i):or a pharmaceutically effective salt or ester thereof alone or in combination with L-DOPA to provide a synergistic effect, thereby providing methods of (1) treating patients with Parkinson's Disease for whom L-DOPA is no longer effective, (2) treating patients with Parkinson's Disease who developed dyskinesia due to L-DOPA, (3) treating patients with Parkinson's Disease who have are receiving deep brain stimulation and (4) treating patients with Parkinson's Disease whose symptoms interfere with activities of daily living.

Described herein are methods for diagnosing high-risk cancer in a subject by detecting PolySialic Acid (polySia) in a biological sample obtained from the subject, or by detecting polySia and one or more tissue-specific markers in a biological sample obtained from the subject.

The present invention teaches a negative magnetic field magnetic moxibustion pillow which includes a pillow noumenon and multiple magnets set inside the described pillow noumenon. The described multiple magnets are set on the substrate based on a preset spacing; one end of the described magnets is a positive pole, and the other end is a negative pole. Moreover, the negative pole of the magnets all face the top surface of the pillow noumenon while the negative magnetic field magnetic moxibustion pillow of this present invention can produce a relatively strong magnetic field for the user.

The invention provides heat-clearing pain-relieving burn and scald ointment with an effect of relieving marks. The ointment is prepared from the following components in parts by weight: 20-25 parts of sea-buckthorn fruit kernels, 12-17 parts of cortex phellodendri, 10-15 parts of spina gleditsiae, 8-14 parts of sophora japonica stems, 8-14 parts of cortex meliae, 7-12 parts of uncaria rhynchophylla, 7-12 parts of caesalpinia sappan, 5-10 parts of camellia, 3-5 parts of fritillaria cirrhosa, 3-5 parts of castor beans, 3-5 parts of eucalyptus oil and 2-3 parts of bornoel. According to the ointment, traditional Chinese herbal medicinal materials are extracted by adopting different alcohol refluxing processes according to different properties of the traditional Chinese herbal medicinal materials instead of a traditional sesame oil extraction method, so that sufficient extraction of effective ingredients is guaranteed, and defects of more impurities and poor medicinal effect of the traditional Chinese medicinal ointment caused by over-high extraction temperature can be avoided. The ointment can be used for effectively clearing heat, removing toxicity, removing necrotic tissues, promoting tissue granulation, promoting wound healing and relieving marks.

The present invention provides a method for evaluating the efficacy of an EGFR-TKI treatment to a subject, comprising identifying the V384D mutation in said subject. By identifying said mutation, the efficacy of the EGFR-TKI treatment and the progression-free survival of said subject after treatment can be estimated.

Both a coating composition comprising a thermosetting resin system and a kit for producing a coating composition using a thermosetting resin system are provided. The coating composition and the kit comprise graphene nanoplatelets, and one or more of a natural or a synthetic oil, silver nanoparticles, a copper powder, titanium nanoparticles, and sepiolite. In the coating composition of the invention and in the coating composition produced from the kit of the invention, the graphene nanoplatelets, natural oil or synthetic oil, silver nanoparticles, copper powder, titanium nanoparticles, and sepiolite are dispersed in the thermosetting resin system.