2682results about "Genetic material delivery route" patented technology

Disclosed are compositions of lipid nanoparticles (LNP) comprising an ionizable cationic lipid, a phospholipid, a sterol, and a PEG-lipid (non-functionalized and optionally functionalized). The functionalized PEG-lipid can be conjugated with a binding moiety to create a targeted LNP (tLNP). The disclosed tLNP preferentially deliver a nucleic acid molecule or other negatively charged payload to cells expressing a cell surface antigen recognized by the binding moiety of the tLNP, and are better tolerated, as compared to LNPs and tLNPs comprising ionizable cationic lipids found in marketed pharmaceuticals comprising LNPs.

The disclosure relates to compositions and methods for the preparation, use, and / or formulation of adeno-associated virus capsid protein variants.

The disclosure relates to compositions and methods for altering, e.g., enhancing, the level of frataxin protein via delivery using an adeno-associated viral (AAV) capsid variant. The compositions and methods of the present disclosure are useful in the treatment of subjects who have, have been diagnosed with having, or are at risk of having a disorder associated with frataxin (FXN) deficiency, e.g., Friedreich's Ataxia.

The disclosure relates to compositions and methods for the preparation, use, and / or formulation of adeno-associated virus capsid protein variants.

The disclosure relates to compositions and methods for the preparation, use, and / or formulation of adeno-associated virus capsid protein variants.

The disclosure relates to compositions and methods for the preparation, use, and / or formulation of adeno-associated virus capsid protein variants.

The invention relates to the field of gene therapy, in particular to an RBM25 gene epigenetics activation technology based on a CRISPR / dCas9-SunTag system and application of the RBM25 gene epigenetics activation technology in ischemic heart failure treatment, the RBM25 gene epigenetics activation technology comprises the following steps: (a) protein containing inactivated Cas9 (dCas9) fused with a plurality of GCN4 peptide repetitive sequences, the number of the GCN4 peptide repetitive sequences is 8-12, and the dCas9 contains D10A and H840A double mutations; (b) a protein containing fusion of an anti-GCN4 single-chain antibody fragment (scFv) and a TET1 catalytic structural domain; (c) at least one gRNA of a target RBM25 gene promoter region, wherein a target sequence of the gRNA is selected from a sequence as shown in SEQ ID NO: 1-3; and (d) a lipid nanoparticle (LNP) system for delivery of said (a), (b), and (c).

Disclosed are compositions of lipid nanoparticles (LNP) comprising an ionizable cationic lipid, a phospholipid, a sterol, and a PEG-lipid (non-functionalized and optionally functionalized). The functionalized PEG-lipid can be conjugated with a binding moiety to create a targeted LNP (tLNP). The disclosed tLNP preferentially deliver a nucleic acid molecule or other negatively charged payload to cells expressing a cell surface antigen recognized by the binding moiety of the tLNP, and are better tolerated, as compared to LNPs and tLNPs comprising ionizable cationic lipids found in marketed pharmaceuticals comprising LNPs.

Methods are provided for the cell-based delivery of collagen VII for the treatment of Epidermolysis Bullosa and corneal erosion. The disclosure also provides a composition and a pharmaceutical composition comprises, comprise, or alternatively consist essentially of, or yet further consist of a keratinocyte sheet or a corneal cell sheet.

Nucleic acid molecules, compositions, recombinant AAV (rAAV) particles, kits, and methods are described herein for delivering a base editor (or “nucleobase editor”) to cells, e.g., via AAV vectors. In particular, the disclosure provides compositions, methods, and uses for delivery of adenine base editors and cytosine base editors in a single AAV vector (or genome). Further described herein are improved AAV vectors containing size-minimized regulatory components that enable, e.g., the packaging of base editors. Provided herein are methods and compositions for delivering base editor proteins to a cell or tissue in a single recombinant AAV (rAAV) vector. Contemplated herein are improved methods and compositions for delivering these base editors in vivo, in a single rAAV particle. Further provided herein are base editors and compositions and cells comprising these base editors.

Disclosed herein are therapeutic applications of CRISPR / Cpf1-based genome editing.

The present disclosure provides compositions and methods useful in the treatment of trinucleotide repeat disorders, including Huntington's disease and Friedreich's ataxia. The present disclosure also provides gRNAs designed to target the HTT or FXN genes. Complexes comprising a base editor and any of the gRNAs disclosed herein are also provided by the present disclosure. The present disclosure further provides polynucleotides, vectors, cells, compositions, and kits. Methods of treating Huntington's disease and Friedreich's ataxia are also provided herein.

The invention relates to application of a multi-target polypeptide in preparation of a medicine for treating organ fibrosis, in particular to application of a polypeptide mini-klotho and a gene therapy vector and method thereof in preparation of medicines for treating fibrosis of kidney, liver, lung and other organs. The invention provides the application of mini-klotho in a model for treating kidney, liver and lung fibrosis, and the mini-klotho has a remarkable curative effect and does not have obvious toxic or side effects. Therefore, the mini-klotho disclosed by the invention can be prepared into a medicinal preparation for treating the organ fibrosis.

The present disclosure provides for recombinant AAV therapies for the treatment of vision loss associated with Friedreich's ataxia. These therapies are designed for administration to subjects, such as human subjects, including humans diagnosed with or suffering from Friedreich's ataxia. The disclosed vectors comprise transgenes that encode frataxin protein, such as a FXN trans gene encoding human frataxin protein.

An isolated nucleic acid that includes the nucleotide sequence: CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 12) is provided. In some embodiment, the nucleic acid includes at least one chemically-modified nucleotide. The nucleic acid and composition containing same find use in treating conditions associated with inflammation and / or fibrosis, for example, without limitation, heart conditions, such as hypertrophic myocardiopathy, myocardial infarction, and heart failure with preserved ejection fraction; muscle disorders, such as muscular dystrophy; skin disorders, such as scleroderma; and inflammatory conditions, such as autoimmune conditions or inflammatory conditions associated with a viral infection.

The instant disclosure relates to lipid particles that harbor cationic lipids, the particles found to be capable of delivering associated cargoes - particularly nucleic acid cargoes when formulated as nucleic acid-lipid particles - intracellularly to skin tissue cells when administered topically to a subject. The instant disclosure provides compositions comprising such lipid particles, optionally in association with a therapeutic agent (e.g., a therapeutic mRNA and / or nucleic acid controller system), as well as methods and kits for delivering a lipid particle-associated therapeutic agent and / or for treating or preventing a disease or disorder, e.g., a skin disease or disorder, in a subject, using one or more lipid particle compositions provided herein.

Provided herein is a lipid nanoparticle (LNP) composition for the localized treatment of skin diseases and a method of treating skin diseases with the LNP composition.

The present invention provides constructs comprising modified riboswitches to regulate expression of a transgene within a subject. Methods of treating a disease, specifically an eye disease, are also contemplated.

Provided are methods for delivering lipid nanoparticles (LNPs) to a lung cell of a subject suffering from or at risk for primary ciliary dyskinesia (PCD), wherein the method comprises nebulizing a liquid pharmaceutical composition to generate an aerosolized pharmaceutical composition, and administering the aerosolized pharmaceutical composition to the subject.

In some aspects, the present disclosure provides compositions comprising an inhibitory polynucleotide and either a guide polynucleotide and / or a polynucleotide that encodes for a nuclease or a nuclease; and a lipid nanoparticle comprising at least one ionizable lipid; wherein the each of the nucleic acids are encapsulated within the lipid nanoparticle, and pharmaceutical compositions thereof. The present disclosure also provides methods employing said compositions and / or pharmaceutical compositions, such as methods of treating diseases or disorders.

The disclosure relates to compositions and methods for the preparation, use, and / or formulation of adeno-associated virus capsid protein variants.

A blood cell-based therapeutic agent delivery system is disclosed. A blood cell-based therapeutic agent delivery vehicle is useful for delivering a therapeutic agent into a recipient organ cell. The blood cell-based therapeutic agent delivery vehicle is made by a method comprising encapsulating the therapeutic agent into a lipid nanoparticle to produce a therapeutic agent-containing lipid nanoparticle, and transfecting the therapeutic agent- containing lipid nanoparticle into a blood cell by incubating the therapeutic agent-containing lipid nanoparticle with the blood cell to form a transfected blood cell. The administration of the transfected blood cell causes the transfected blood cell to be in close proximity to or direct contact with the recipient organ cell, thereby causing a transfer of the therapeutic agent into the recipient organ cell. A composition for a blood cell-based therapeutic agent delivery vehicle for use in delivering a therapeutic agent into a recipient organ cell is also disclosed.

The present disclosure provides materials and methods for delivery of a transgene to target cells. The regulatory elements, transgenes, and expression vectors are useful in, e.g., expressing a transgene in CNS cells that results in an improvement in at least one symptom related to a neurological disease or disorder, including epilepsy disorders, such as refractory epilepsy.

The technology described herein is directed to methods of administering a recombinant adeno-associated virus (rAAV) to a kidney of a subject using a retrograde ureter route. Such administration methods can be used to treat a kidney-associated disorder in a subject in need thereof. Also described herein are pharmaceutical compositions comprising a recombinant adeno-associated virus (rAAV) for administration to the kidney.

This disclosure relates compositions and methods to delivery of various agents to the inner ear of a subject.

The present invention is directed to lipid nanoparticles using cationic cholesterol for topical delivery for nucleic acid delivery, and when administered locally, side effects caused by systemic drug delivery can be minimized and protein expression can be confined to the site of administration. In addition, the duration of protein expression at the site of administration can be increased, and thus the lipid nanoparticles can be useful in the technical field related to nucleic acid therapeutics.

Disclosed herein are therapeutic applications of CRISPR / Cpf1-based genome editing.

The present invention belongs to the field of biotechnology, and discloses capsid protein mutants and applications for improving AAV virus yield and whole-eye infection ability. Capsid protein mutants are obtained by replacing amino acids 561 to 588 of wild-type AAV2 virus capsid protein with specific polypeptides. Capsid protein mutants of some examples of the present invention can effectively improve the whole-eye infection ability of AAV2, fundamentally solving the problem of AAV2 eye infection efficiency. Capsid protein mutants of some examples of the present invention have better yield. Capsid protein mutants of some examples of the present invention can be well applied to gene therapy of the eye or construction of eye disease models.

The disclosure provides polynucleotides containing regions of the Myosin 15 (Myo15) promoter, as well as vectors containing the same, that can be used to promote expression of a transgene specifically in hair cells. The polynucleotides described herein may be operably linked to a transgene, such as a transgene encoding a therapeutic protein, so as to promote hair cell-specific expression of the transgene. The polynucleotides described herein may be operably linked to a therapeutic transgene and used for the treatment of subjects having or at risk of developing hearing loss or vestibular dysfunction.