Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

53 results about "Antiandrogen" patented technology

Antiandrogens, also known as androgen antagonists or testosterone blockers, are a class of drugs that prevent androgens like testosterone and dihydrotestosterone (DHT) from mediating their biological effects in the body. They act by blocking the androgen receptor (AR) and/or inhibiting or suppressing androgen production. They can be thought of as the functional opposites of AR agonists, for instance androgens and anabolic steroids (AAS) like testosterone, DHT, and nandrolone and selective androgen receptor modulators (SARMs) like enobosarm. Antiandrogens are one of three types of sex hormone antagonists, the others being antiestrogens and antiprogestogens.

Irreversible non-steroidal antagonist compound and its use in the treatment of prostate cancer

The present invention relates to an antiandrogen compound and a method of treating prostate cancer in a patient utilizing the compound. The present invention also relates to a pharmaceutical composition which includes the compound.
Owner:UNIV OF TENNESSEE RES FOUND

17alpha-substituted steroids as systemic antiandrogens and selective androgen receptor modulators

ActiveUS20090042844A1Good systemic bioavailabilityReduce riskOrganic active ingredientsBiocideWhole bodyAndrogen dependent
Compounds having the structure, their salts or N-oxide derivatives:are used to treat or reduce le likelihood of acquiring androgen-dependent diseases, such as prostate cancer, benign prostatic hyperplasia, polycystic ovarian syndrome, acne, hirsutism, seborrhea, androgenic alopecia and male baldness. They can be formulated together with pharmaceutically acceptable diluent or carrier or otherwise made into any pharmaceutical dosage form. Combinations with other active pharmaceutical agents are also disclosed.
Owner:ENDORES & DEV

Steroidal antiestrogens and antiandrogens and uses thereof

InactiveUS7041839B2Inhibit transcriptional responseEffective treatmentOrganic active ingredientsSteroidsDiseaseSide effect
The present invention comprises the design, synthesis and development of a new class of chemotherapeutic agents for prophylactic and therapeutic treatments in a mammal, particularly a human, believed to be at risk of suffering from a hormone-responsive disorde. In an embodiment of the invention, such treatments include therapeutic compositions comprising novel steroidal antiestrogen and antiandrogen compounds. In a preferred embodiment, such a novel compound of the present invention has an address and a message component, which are made into a single composite entity for more aggressive intervention and effective treatment of hormone-responsive disorders, thereby prolonging the disease-free interval for the patient and reducing a number of side effects.
Owner:NORTHEASTERN UNIV

Combination Therapies and Methods of Use Thereof for Treating Cancer

Pharmaceutical compositions including an effective amount of an antiandrogen or androgen antagonist in combination with a Plk inhibitor and methods of use thereof for treating cancer are disclosed. Administration of the combination of the active agents can be effective to reduce cancer cell proliferation or viability in a subject with cancer to the same degree, or a greater degree than administering to the subject the same amount of either active agent alone. The active agents can be administered together or separately. Methods of selecting and treating subjects with cancers, particular prostate cancers including castration resistant prostate cancer, breast cancers, particularly androgen receptor positive breast cancers, and pancreatic cancers are also provided.
Owner:MASSACHUSETTS INST OF TECH

Compounds and Formulations

The instant invention provides potent antiandrogen compounds, such as 3β-acetoxyandrost-1,5-diene-17-ethylene ketal and 3β-hydroxyandrost-1,5-diene-17-ethylene ketal, and methods for their use in the prevention and treatment of biological conditions mediated by androgen receptors. Thus, for example, compounds of the invention are useful in the prevention and treatment of prostrate cancer. Furthermore, it has been discovered that compounds of the invention are useful in the prevention and treatment of androgen-independent cancers such as androgen-independent prostrate cancer. Finally, inventive compounds may be used to treat antiandrogen induced withdrawal syndrome.
Owner:NEURMEDIX +2

Antiandrogens

Androgen nucleus derivatives having specified substituents at the 17 alpha position are disclosed for use as antiandrogens for the treatment of androgen-dependent diseases. In some preferred embodiments, the compound is formulated together with pharmaceutically acceptable diluent or carrier for topical use in the treatment of androgen-dependent diseases associated with the skin.
Owner:ENDORES & DEV

Thiohydantoin ternary fused cyclic androgen receptor antagonist and application thereof

The invention relates to the field of medicinal chemistry, in particular to prostatic cancer resisting compounds (I) and (II) with thiohydantoin diindyl as skeletons and a preparation method of the compounds. The compounds are capable of molecularly antagonizing androgen receptors and excellent in prostatic cancer resisting effect in cellular level and animal level and can be used for preparation of antitumor medicines.
Owner:CHINA PHARM UNIV

Method for the treatment of cancer

Provided is a method for determining the prognosis of cancer in a female patient with a solid tumor. Also provided is a method of sensitizing a cancer cell from a solid tumor from a male patient other than a prostate cancer cell to treatment with a chemotherapeutic agent comprising administering an effective amount of(a)(i) at least one antiandrogen;(ii) at least one inhibitor of androgen synthesis; or(iii) a combination of at least one antiandrogen and at least one inhibitor of androgen synthesis; and(b) at least one chemotherapeutic agent other than an antiandrogen or an inhibitor of androgen synthesis for the treatment of cancer characterized by a solid tumor, other than prostate cancer, in a male patient. The antiandrogen, the inhibitor of androgen synthesis, or the combination of both may be administered before, after, or at the same time as the chemotherapeutic agent.
Owner:WESTERN CONNECTICUT HEALTH NETWORK

Prostate Cancer Treatment

The instant invention provides potent antiandrogen compounds, such as 3β-acetoxyandrost-1,5-diene-17-ethylene ketal and 3β-hydroxyandrost-1,5-diene-17-ethylene ketal, and methods for their use in the prevention and treatment of biological conditions mediated by androgen receptors. Thus, for example, compounds of the invention are useful in the prevention and treatment of prostrate cancer. Furthermore, it has been discovered that compounds of the invention are useful in the prevention and treatment of androgen-independent cancers such as androgen-independent prostrate cancer. Finally, inventive compounds may be used to treat antiandrogen induced withdrawal syndrome.
Owner:NEURMEDIX +2

Construction and application of a model for distinguishing between androgen and antiandrogen effects of substance

InactiveCN109285584AReduced stabilityGuaranteed stabilitySequence analysisSystems biologySurflex dockHydroxyflutamide
The invention belongs to the technical field of testing or analyzing substances by measuring chemical or physical properties, and discloses a model for distinguishing between androgen and antiandrogeneffects of a substance, and a construction method and application thereof. The model for distinguishing between androgen and antiandrogen effects of the substance adopts a Surflex-Dock program of theSYBYL to dock a ligand into an AR. The model is established by binding mode of dihydrotestosterone (DHT) and hydroxyflutamide (HFT) with AR, and is further used in a novel brominated flame retardant;after the simulation is ended, the agreement between the antagonist-bound H12 helix and other structures is significantly weakened, so that the stability of the H12 helix is reduced, but the agonistcan maintain the stability of H12; and the method can be used to initially screen the agonism and antagonism of the substance.
Owner:NANJING UNIV

Combination therapies and methods of use thereof for treating cancer

Pharmaceutical compositions including an effective amount of an antiandrogen or androgen antagonist in combination with a Plk inhibitor and methods of use thereof for treating cancer are disclosed. Administration of the combination of the active agents can be effective to reduce cancer cell proliferation or viability in a subject with cancer to the same degree, or a greater degree than administering to the subject the same amount of either active agent alone. The active agents can be administered together or separately. Methods of selecting and treating subjects with cancers, particular prostate cancers including castration resistant prostate cancer, breast cancers, particularly androgen receptor positive breast cancers, and pancreatic cancers are also provided.
Owner:MASSACHUSETTS INST OF TECH

Methods and materials for assessing prostate cancer therapies and compounds

A modest (2-5 fold) increase in androgen receptor (AR) mRNA is the only expression change consistently associated with developing resistance to antiandrogen therapy. Increased levels of AR confer resistance to anti-androgens by amplifying signal output from low levels of residual ligand and altering the normal response to antagonists. This invention provides cell based assays for use in the examination of new therapeutic modalities and provides for the design of novel antiandrogen compounds.
Owner:RGT UNIV OF CALIFORNIA

Antiandrogen oligonucleotides usable for the treatment of dermatological androgen-related disorders relating to androgen metabolism, their pharmaceutical compositions, their uses and treatment method

Antiandrogen oligonucleotides suitable for the treatment of hair loss and androgen-metabolism related skin disorders. The oligonucleotides having the sequences: INN-18.1:5′ CATTGGTGAAGGATCGCC 3′(SEQ ID N° 1)INN-24:5′ CAATCATTTCTGCTGGCG 3′(SEQ ID N° 2)INN-71:5′ GGCCTTCTTCGGCTGTGAAG 3′(SEQ ID N° 3)INN-72:5′ CACACGGTCCATACAACTGG 3′(SEQ ID N° 4)INN-18.2:5′ GGCGAAGTAGAGCATCCT 3′(SEQ ID N° 5)INN-24.1:5′ TGG CGC ACA GGT ACT TCT 3′(SEQ ID N° 6)INN-73:5′ CCA CCA CCA CCA CAC GG 3′(SEQ ID N° 7)INN-76:5′ GCC GCC ACC ACC CCC ACC 3′(SEQ ID N° 8)These anti-androgenic active principles are specific to reach their molecular target, which is circumscribed to the site of application. The oligonucleotides described inhibit the androgen receptor (AR) expression at very low concentrations in skin and hair follicle primary cell cultures, through a mechanism implying the reaching of, and the hibridizing with, specific regions of the AR mRNA, thereby triggering the RNAse H digestion of the AR mRNA and thus inhibiting the AR translation.
Owner:KERNER NESTOR +2

Androgen receptor ligands

Non ligand binding pocket antagonists for the human androgen receptor. The androgen receptor (AR) is a member of the Nuclear Receptor (NR) family and its role is to modulate the biological effects of the endogenous androgens, testosterone (tes) and dihydrotestosterone (DHT). Synthetic androgens and anti-androgens have therapeutic value in the treatment of various androgen dependent conditions, from regulation of male fertility to prostate cancer. Current treatment of prostate cancer (PCa) typically involves administration of ‘classical’ antiandrogens, competitive inhibitors of natural AR ligands, DHT and tes, for the ligand binding pocket (LBP) in the C-terminal ligand binding domain (LBD) of the AR. However, prolonged LBP-targeting can often lead to androgen resistance and alternative therapies and therapeutic strategies are urgently required. Disclosed herein are a class of non-steroidal, small molecule AR antagonists which inhibit the transcriptional activity of the AR by non LBP-mediated modulation. The novel class reported demonstrates full (‘true’) antagonism in AR with low micromolar potency, high selectivity over both the Estrogen Receptors alpha and beta (ERα and ERβ) and the Glucocorticoid Receptor (GR) and only micromolar partial antagonism in the Progesterone Receptor (PR). Data provide compelling evidence for such non-LBP intervention as an alternative approach to classical PCa therapy. (Formula I).
Owner:TRINITY COLLEGE DUBLIN

Method of treatment of prostate cancer and composition for treatment thereof

A method and composition for the treatment of prostate cancer comprises an effective amount of a nonsteroidal antiandrogen and an effective amount of a selective estrogen receptor modulator. The composition has fewer side effects such as breast tenderness and gynecomastia and also is more effective as an adjuvant therapy to prevent the reoccurrence of prostate cancer.
Owner:CASTLE ERIK P

Locally active "soft" antiandrogens

The present invention relates to antiandrogenic compounds which may be administered for the treatment of androgen excess in the skin and by way of consequence, the treatment of acne, baldness or hirsuitism in subject or patient. These compounds have the general chemical structure I, II, III or IV:
Owner:YALE UNIV

Methods and materials for assessing prostate cancer therapies and compounds

ActiveUS20070191443A1Strong and weak physiological effectInhibits biological functionBiocideOrganic chemistryCompound aCell based assays
A modest (2-5 fold) increase in androgen receptor (AR) mRNA is the only expression change consistently associated with developing resistance to antiandrogen therapy. Increased levels of AR confer resistance to anti-androgens by amplifying signal output from low levels of residual ligand and altering the normal response to antagonists. This invention provides cell based assays for use in the examination of new therapeutic modalities and provides for the design of novel antiandrogen compounds.
Owner:RGT UNIV OF CALIFORNIA

17alpha-substituted steroids as systemic antiandrogens and selective androgen receptor modulators

Compounds having the structure, their salts or N-oxide derivatives:are used to treat or reduce le likelihood of acquiring androgen-dependent diseases, such as prostate cancer, benign prostatic hyperplasia, polycystic ovarian syndrome, acne, hirsutism, seborrhea, androgenic alopecia and male baldness. They can be formulated together with pharmaceutically acceptable diluent or carrier or otherwise made into any pharmaceutical dosage form. Combinations with other active pharmaceutical agents are also disclosed.
Owner:ENDORES & DEV

Hybrid-ionone and curcumin molecules as anticancer agents

The present invention relates to the synthesis of a series of ionone and curcumin derivatives as multi-targeting agents effective against both hormone-sensitive and hormone-independent cancers. In particular, the present invention is directed to a distinct class of bifunctional antiandrogens, which inhibit both AR and IKBkinases (IKK). A series of ionone-based chalcones were synthesized and their in vitro cytotoxicity against prostate cancer cell lines were demonstrated. A series of derivatives formed by reacting ionone-based chalcones and hydrazines demonstrate substantial antiproliferative activities in prostate cancer, breast cancer and lung cancer cell lines.
Owner:TRT PHARMA

Hair loss-prevention and hair growth agent composition

The invention relates to the technical field of cosmetics, and in particular, relates to a hair loss-prevention and hair growth agent composition and a preparation method thereof. The hair loss-prevention and hair growth agent composition is composed of 0.1-5 parts by weight of cholest-3,5-diene, 0.5-6 parts of a hair growth agent and 0.2-1 part of an antiandrogen drug as effective ingredients. The prepared hair loss-prevention and hair growth agent composition adopts cholest-3,5-diene, the hair growth agent and the antiandrogen drug as the effective ingredients cooperating with bioactive polypeptide and a white birch extract together, acts on scalps, and appears growth effect of hairy papillary cells; through clinical experiment results, the composition is proved to be able to significantly improve the scalp environment and promote hair growth. Therefore, the product can be used in cosmetics or skin external application agents for preventing hair loss, improving hair loss, treating hair loss or promoting hair growth.
Owner:上海龙禧投资有限公司

Compositions and methods for treating androgen-independent cancer

Compositions and methods are provided herein for the prevention and treatment of cancer, including prostate cancer, breast cancer, and androgen-independent cancer. In one aspect, the present invention provides a composition comprising a niclosamide analog and an antiandrogen drug. In some embodiments, the compositions and methods provided herein inhibit a mutant or splice variant androgen receptor. In particular embodiments, the compositions and methods provided herein reduce the androgen independence of a cancer. Kits are also provided herein.
Owner:U S GOVERNMENT REPRESENTED BY THE DEPT OF VETERANS AFFAIRS +1

Kits for antiandrogen therapy monitoring

The present invention provides methods of evaluating the effectiveness of an antiandrogen therapy in a human by comparing the pre- and post antiandrogen treatment levels of an androgen modulated diagnostic marker and a prostate-specific, androgen independent, diagnostic marker in the human. Methods utilizing these markers are also provided that are useful for identifying antiandrogen compounds capable of killing prostate cancer cells, and identifying a human suspected of responding more, or less, favorably to treatment with an antiandrogen compound and monitoring the treatment thereof. Kits and compositions related to these methods are also provided.
Owner:GEN PROBE INC

Antiandrogen oligonucleotides usable for the treatment of dermatological androgen-related disorders relating to androgen metabolism, their pharmaceutical compositions, their uses and treatment method

Antiandrogen oligonucleotides suitable for the treatment of hair loss and androgen-metabolism related skin disorders. The oligonucleotides having the sequences:INN-18.1(SEQ ID No 1):5′ CATTGGTGAAGGATCGCC 3′INN-24(SEQ ID No 2):5′ CAATCATTTCTGCTGGCG 3′INN-71(SEQ ID No 3):5′ GGCCTTCTTCGGCTGTGAAG 3′INN-72(SEQ ID No 4):5′ CACACGGTCCATACAACTGG 3′INN-18.2(SEQ ID No 5):5′ GGCGAAGTAGAGCATCCT 3INN-24.1(SEQ ID No 6):5′ TGG CGC ACA GGT ACT TCT 3′INN-73(SEQ ID No 7):5′ CCA CCA CCA CCA CAC GG 3′INN-76(SEQ ID No 8):5′ GCC GCC ACC ACC CCC ACC 3′These anti-androgenic active principles are specific to reach their molecular target, which is circumscribed to the site of application. The oligonucleotides described inhibit the androgen receptor (AR) expression at very low concentrations in skin and hair follicle primary cell cultures, through a mechanism implying the reaching of, and the hibridizing with, specific regions of the AR mRNA, thereby triggering the RNAse H digestion of the AR mRNA and thus inhibiting the AR translation.
Owner:KERNER NESTOR ALBERTO +2

Preparation method of 4-amino-2-fluoro-methyl benzamide

The invention belongs to the field of pharmaceutical engineering and in particular relates to a preparation method of novel antiandrogen drug MDV (Marek's Disease Virus) 3100 key intermediate 4-amino-2-fluoro-methyl benzamide. In order to overcome the problem that the environment is polluted in the preparation process of the 4-amino-2-fluoro-methyl benzamide in the prior art, the invention provides a method for preparing 4-amino-2-fluoro-methyl benzamide by using 2-fluoro-4-nitrotoluen as the material through potassium permanganate oxidation, methylamination and Pd / C hydrogenation reduction reaction. The preparation method is a cleaning process production technology, simple in process operation and suitable for large-scale production. The preparation method of the 4-amino-2-fluoro-methyl benzamide disclosed by the invention has the advantages as follows: the yield of the process for obtaining 4-amino-2-fluoro-methyl benzamide by Pd / C catalytic hydrogenation is as high as 98%, the product purity is 98% or higher, the wastewater amount is less, and the catalyst and the organic solvent can be recycled for use; and in terms of the 2-fluoro-4-nitrotoluen, the tree-step total yield is as high as 68.2%.
Owner:台州煜农生物科技有限公司

Process for the Preparation of Drospirenone

ActiveUS20130030169A1SteroidsDrospirenoneMegestrol
A process is described, comprising the oxidation of 17α-(3-hydroxypropyl)-6β,7β,15β,16β-dimethylen-5β-androstan-3β,5,17β-triol, for the preparation of drospirenone, a synthetic steroid with progestogenic, antimineralocorticoid and antiandrogenic activity, useful for preparing pharmaceutical compositions with contraceptive action.
Owner:IND CHEM SRL

New medicament usage of paeonol unction

The invention relates to new medical use of paeonol ointment, namely, the application of the paeonol ointment for preparing a medicine for treating common acne. Acne is a chronic and phlogistic skin disease of hair follicles and sebaceous glands. In Western medicines, antibiotics and antiandrogen for incretion regulation, and retinoic acid medicines are commonly used, although the medicines have curative effect, side effects are in a large amount, and misuse of the medicines by female can cause congenital malformation to infants. In Chinese medicines, loquat lung clearing decoction and antiphlogistic decoction of five drugs are commonly used for peroral treatment, but have suboptimal taste, thereby being uneasily accepted by patients. The paeonol ointment is an antiallergic medicine for external use, and applicants use the paeonol ointment for treating acne, with the total effectiveness ratio of 100 percent.
Owner:HEFEI LIFEON PHARMA

Compound with antiandrogen activity as well as preparation method and application of compound

The invention belongs to the technical field of biological medicines and particularly relates to a compound with antiandrogen activity as well as a preparation method and application of the compound. The compound provided by the invention has the chemical name as follows: 4-(3-(4-cyano-3-(trifluoromethyl)phenyl)-5, 5-dimethyl-2, 4-dioxo-1-imidazolyl)butyl acetate. The preparation method comprises the step of enabling an intermediate compound IV and 4-bromobutyl acetate to react at the temperature of 10-60 DEG C under the catalysis of a catalyst to prepare the compound. The compound can be used for preparing antiandrogen drugs. The preparation method is simple; in addition, the obtained compound is high in bioavailability and antiandrogen activity.
Owner:上海孚一生物科技有限公司 +1
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More