53 results about "Antiandrogen" patented technology

PCT No. PCT / EP95 / 05008 Sec. 371 Date Aug. 4, 1997 Sec. 102(e) Date Aug. 4, 1997 PCT Filed Dec. 18, 1995 PCT Pub. No. WO96 / 20210 PCT Pub. Date Jul. 4, 1996Disclosed are compounds of formula (A) wherein X, R1 and Y are as defined by the specification. The compounds are useful as antiandrogenic agents.

The present invention relates to an antiandrogen compound and a method of treating prostate cancer in a patient utilizing the compound. The present invention also relates to a pharmaceutical composition which includes the compound.

The present invention provides treatment regimens for treating diseased prostate tissue, including the steps of chemically ablating prostate tissue and coadministering an antiandrogen. In some embodiments, prostate tissue is chemically ablated by injection of ethanol, or an injectable gel comprising ethanol, into prostate tissue. Steroidal and non-steroidal antiandrogens are suitable antiandrogens. One suitable non-steroidal antiandrogen is bicalutamide. The treatment regimen is suitable for treatment of prostate tissue diseases including benign prostatic hyperplasia and prostatic carcinoma. The invention further provides a treatment regimen for treating benign prostatic hyperplasia, including the steps of damaging prostate tissue and coadministering an antiandrogen. Also provided by the present invention is a kit for treating a human male, including a means for necrosing prostate tissue, an antiandrogen drug, and a means for administering the antiandrogen drug. A kit including a first surgical device for delivering a chemoablation fluid to prostate tissue transurethrally, an antiandrogen drug such as bicalutamide, and a second surgical device for administering the antiandrogen drug, is further provided.

The invention belongs to the technical field of testing or analyzing substances by measuring chemical or physical properties, and discloses a model for distinguishing between androgen and antiandrogeneffects of a substance, and a construction method and application thereof. The model for distinguishing between androgen and antiandrogen effects of the substance adopts a Surflex-Dock program of theSYBYL to dock a ligand into an AR. The model is established by binding mode of dihydrotestosterone (DHT) and hydroxyflutamide (HFT) with AR, and is further used in a novel brominated flame retardant;after the simulation is ended, the agreement between the antagonist-bound H12 helix and other structures is significantly weakened, so that the stability of the H12 helix is reduced, but the agonistcan maintain the stability of H12; and the method can be used to initially screen the agonism and antagonism of the substance.

A modest (2-5 fold) increase in androgen receptor (AR) mRNA is the only expression change consistently associated with developing resistance to antiandrogen therapy. Increased levels of AR confer resistance to anti-androgens by amplifying signal output from low levels of residual ligand and altering the normal response to antagonists. This invention provides cell based assays for use in the examination of new therapeutic modalities and provides for the design of novel antiandrogen compounds.

The present invention relates to antiandrogenic compounds which may be administered for the treatment of androgen excess in the skin and by way of consequence, the treatment of acne, baldness or hirsuitism in subject or patient. These compounds have the general chemical structure I, II, III or IV:

The present invention relates to the synthesis of a series of ionone and curcumin derivatives as multi-targeting agents effective against both hormone-sensitive and hormone-independent cancers. In particular, the present invention is directed to a distinct class of bifunctional antiandrogens, which inhibit both AR and IKBkinases (IKK). A series of ionone-based chalcones were synthesized and their in vitro cytotoxicity against prostate cancer cell lines were demonstrated. A series of derivatives formed by reacting ionone-based chalcones and hydrazines demonstrate substantial antiproliferative activities in prostate cancer, breast cancer and lung cancer cell lines.

Antiandrogen oligonucleotides suitable for the treatment of hair loss and androgen-metabolism related skin disorders. The oligonucleotides having the sequences:INN-18.1(SEQ ID No 1):5′ CATTGGTGAAGGATCGCC 3′INN-24(SEQ ID No 2):5′ CAATCATTTCTGCTGGCG 3′INN-71(SEQ ID No 3):5′ GGCCTTCTTCGGCTGTGAAG 3′INN-72(SEQ ID No 4):5′ CACACGGTCCATACAACTGG 3′INN-18.2(SEQ ID No 5):5′ GGCGAAGTAGAGCATCCT 3INN-24.1(SEQ ID No 6):5′ TGG CGC ACA GGT ACT TCT 3′INN-73(SEQ ID No 7):5′ CCA CCA CCA CCA CAC GG 3′INN-76(SEQ ID No 8):5′ GCC GCC ACC ACC CCC ACC 3′These anti-androgenic active principles are specific to reach their molecular target, which is circumscribed to the site of application. The oligonucleotides described inhibit the androgen receptor (AR) expression at very low concentrations in skin and hair follicle primary cell cultures, through a mechanism implying the reaching of, and the hibridizing with, specific regions of the AR mRNA, thereby triggering the RNAse H digestion of the AR mRNA and thus inhibiting the AR translation.