53 results about "Antiandrogen" patented technology

PCT No. PCT / EP95 / 05008 Sec. 371 Date Aug. 4, 1997 Sec. 102(e) Date Aug. 4, 1997 PCT Filed Dec. 18, 1995 PCT Pub. No. WO96 / 20210 PCT Pub. Date Jul. 4, 1996Disclosed are compounds of formula (A) wherein X, R1 and Y are as defined by the specification. The compounds are useful as antiandrogenic agents.

The present invention relates to an antiandrogen compound and a method of treating prostate cancer in a patient utilizing the compound. The present invention also relates to a pharmaceutical composition which includes the compound.

The present invention provides treatment regimens for treating diseased prostate tissue, including the steps of chemically ablating prostate tissue and coadministering an antiandrogen. In some embodiments, prostate tissue is chemically ablated by injection of ethanol, or an injectable gel comprising ethanol, into prostate tissue. Steroidal and non-steroidal antiandrogens are suitable antiandrogens. One suitable non-steroidal antiandrogen is bicalutamide. The treatment regimen is suitable for treatment of prostate tissue diseases including benign prostatic hyperplasia and prostatic carcinoma. The invention further provides a treatment regimen for treating benign prostatic hyperplasia, including the steps of damaging prostate tissue and coadministering an antiandrogen. Also provided by the present invention is a kit for treating a human male, including a means for necrosing prostate tissue, an antiandrogen drug, and a means for administering the antiandrogen drug. A kit including a first surgical device for delivering a chemoablation fluid to prostate tissue transurethrally, an antiandrogen drug such as bicalutamide, and a second surgical device for administering the antiandrogen drug, is further provided.

The invention relates to the field of medicinal chemistry, in particular to prostatic cancer resisting compounds (I) and (II) with thiohydantoin diindyl as skeletons and a preparation method of the compounds. The compounds are capable of molecularly antagonizing androgen receptors and excellent in prostatic cancer resisting effect in cellular level and animal level and can be used for preparation of antitumor medicines.

The instant invention provides potent antiandrogen compounds, such as 3β-acetoxyandrost-1,5-diene-17-ethylene ketal and 3β-hydroxyandrost-1,5-diene-17-ethylene ketal, and methods for their use in the prevention and treatment of biological conditions mediated by androgen receptors. Thus, for example, compounds of the invention are useful in the prevention and treatment of prostrate cancer. Furthermore, it has been discovered that compounds of the invention are useful in the prevention and treatment of androgen-independent cancers such as androgen-independent prostrate cancer. Finally, inventive compounds may be used to treat antiandrogen induced withdrawal syndrome.

The invention belongs to the technical field of testing or analyzing substances by measuring chemical or physical properties, and discloses a model for distinguishing between androgen and antiandrogeneffects of a substance, and a construction method and application thereof. The model for distinguishing between androgen and antiandrogen effects of the substance adopts a Surflex-Dock program of theSYBYL to dock a ligand into an AR. The model is established by binding mode of dihydrotestosterone (DHT) and hydroxyflutamide (HFT) with AR, and is further used in a novel brominated flame retardant;after the simulation is ended, the agreement between the antagonist-bound H12 helix and other structures is significantly weakened, so that the stability of the H12 helix is reduced, but the agonistcan maintain the stability of H12; and the method can be used to initially screen the agonism and antagonism of the substance.

Pharmaceutical compositions including an effective amount of an antiandrogen or androgen antagonist in combination with a Plk inhibitor and methods of use thereof for treating cancer are disclosed. Administration of the combination of the active agents can be effective to reduce cancer cell proliferation or viability in a subject with cancer to the same degree, or a greater degree than administering to the subject the same amount of either active agent alone. The active agents can be administered together or separately. Methods of selecting and treating subjects with cancers, particular prostate cancers including castration resistant prostate cancer, breast cancers, particularly androgen receptor positive breast cancers, and pancreatic cancers are also provided.

A modest (2-5 fold) increase in androgen receptor (AR) mRNA is the only expression change consistently associated with developing resistance to antiandrogen therapy. Increased levels of AR confer resistance to anti-androgens by amplifying signal output from low levels of residual ligand and altering the normal response to antagonists. This invention provides cell based assays for use in the examination of new therapeutic modalities and provides for the design of novel antiandrogen compounds.

Non ligand binding pocket antagonists for the human androgen receptor. The androgen receptor (AR) is a member of the Nuclear Receptor (NR) family and its role is to modulate the biological effects of the endogenous androgens, testosterone (tes) and dihydrotestosterone (DHT). Synthetic androgens and anti-androgens have therapeutic value in the treatment of various androgen dependent conditions, from regulation of male fertility to prostate cancer. Current treatment of prostate cancer (PCa) typically involves administration of ‘classical’ antiandrogens, competitive inhibitors of natural AR ligands, DHT and tes, for the ligand binding pocket (LBP) in the C-terminal ligand binding domain (LBD) of the AR. However, prolonged LBP-targeting can often lead to androgen resistance and alternative therapies and therapeutic strategies are urgently required. Disclosed herein are a class of non-steroidal, small molecule AR antagonists which inhibit the transcriptional activity of the AR by non LBP-mediated modulation. The novel class reported demonstrates full (‘true’) antagonism in AR with low micromolar potency, high selectivity over both the Estrogen Receptors alpha and beta (ERα and ERβ) and the Glucocorticoid Receptor (GR) and only micromolar partial antagonism in the Progesterone Receptor (PR). Data provide compelling evidence for such non-LBP intervention as an alternative approach to classical PCa therapy. (Formula I).

The present invention relates to antiandrogenic compounds which may be administered for the treatment of androgen excess in the skin and by way of consequence, the treatment of acne, baldness or hirsuitism in subject or patient. These compounds have the general chemical structure I, II, III or IV:

Compounds having the structure, their salts or N-oxide derivatives:are used to treat or reduce le likelihood of acquiring androgen-dependent diseases, such as prostate cancer, benign prostatic hyperplasia, polycystic ovarian syndrome, acne, hirsutism, seborrhea, androgenic alopecia and male baldness. They can be formulated together with pharmaceutically acceptable diluent or carrier or otherwise made into any pharmaceutical dosage form. Combinations with other active pharmaceutical agents are also disclosed.

The present invention relates to the synthesis of a series of ionone and curcumin derivatives as multi-targeting agents effective against both hormone-sensitive and hormone-independent cancers. In particular, the present invention is directed to a distinct class of bifunctional antiandrogens, which inhibit both AR and IKBkinases (IKK). A series of ionone-based chalcones were synthesized and their in vitro cytotoxicity against prostate cancer cell lines were demonstrated. A series of derivatives formed by reacting ionone-based chalcones and hydrazines demonstrate substantial antiproliferative activities in prostate cancer, breast cancer and lung cancer cell lines.

Compositions and methods are provided herein for the prevention and treatment of cancer, including prostate cancer, breast cancer, and androgen-independent cancer. In one aspect, the present invention provides a composition comprising a niclosamide analog and an antiandrogen drug. In some embodiments, the compositions and methods provided herein inhibit a mutant or splice variant androgen receptor. In particular embodiments, the compositions and methods provided herein reduce the androgen independence of a cancer. Kits are also provided herein.

The present invention provides methods of evaluating the effectiveness of an antiandrogen therapy in a human by comparing the pre- and post antiandrogen treatment levels of an androgen modulated diagnostic marker and a prostate-specific, androgen independent, diagnostic marker in the human. Methods utilizing these markers are also provided that are useful for identifying antiandrogen compounds capable of killing prostate cancer cells, and identifying a human suspected of responding more, or less, favorably to treatment with an antiandrogen compound and monitoring the treatment thereof. Kits and compositions related to these methods are also provided.

Antiandrogen oligonucleotides suitable for the treatment of hair loss and androgen-metabolism related skin disorders. The oligonucleotides having the sequences:INN-18.1(SEQ ID No 1):5′ CATTGGTGAAGGATCGCC 3′INN-24(SEQ ID No 2):5′ CAATCATTTCTGCTGGCG 3′INN-71(SEQ ID No 3):5′ GGCCTTCTTCGGCTGTGAAG 3′INN-72(SEQ ID No 4):5′ CACACGGTCCATACAACTGG 3′INN-18.2(SEQ ID No 5):5′ GGCGAAGTAGAGCATCCT 3INN-24.1(SEQ ID No 6):5′ TGG CGC ACA GGT ACT TCT 3′INN-73(SEQ ID No 7):5′ CCA CCA CCA CCA CAC GG 3′INN-76(SEQ ID No 8):5′ GCC GCC ACC ACC CCC ACC 3′These anti-androgenic active principles are specific to reach their molecular target, which is circumscribed to the site of application. The oligonucleotides described inhibit the androgen receptor (AR) expression at very low concentrations in skin and hair follicle primary cell cultures, through a mechanism implying the reaching of, and the hibridizing with, specific regions of the AR mRNA, thereby triggering the RNAse H digestion of the AR mRNA and thus inhibiting the AR translation.