34 results about "CCL5" patented technology

Biomarker-based treatment, monitoring, and diagnostic methods for IL-17 dependent conditions, including hidradenitis suppurativa, are disclosed. The biomarkers may be selected from IL6, PLA2G2A, IL19, P13, CST7, IL17A, IL17F, GH1, MZB1, IL1B, IFNG, TNC, CXCL9, SLAMF7, VEGFA, IL17C, SLAMF1, SDC1, OSM, LBP, REG3A, CD79B, COL4A1, CLEC4D, VWF, IL5RA, CSF3, TGFA, IL2RA, ITIH3, FCAR, CCL23, NRCAM, RETN, SERPINA11, CLEC4G, CSF1, HGF, CRELD2, EFEMP1, LTBR, NME3, CKAP4, CD276, SPON2, GGH, TIMP1, LY9, MCFD2, TCN2, QPCT, HYOU1, TNSFSF13B, CCL2, CCL3, CCL4, CCL5, CCL7, CCL20, CXCL1, CXCL8, PDFGA, CXCR2, CCR6, CXCL13, PCDH1, BOC, MEPE, ADAM 23, THOP1, IL1RL2, RCOR1, EDAR, and combinations thereof. Kits for measuring the biomarkers, diagnosing and treating IL-17-dependent conditions, and identifying super-responders are also disclosed.

The disclosure provides methods and uses of CCL5 variants for modulating GPR75 signaling in a cell or subject, treating a GPR75-related disease or disorder in a subject, treating obesity, hypertension, metabolic syndrome, metabolic dysfunction-associated steatohepatitis, and / or diabetes in a subject, and inducing weight loss and / or preventing weight gain in a subject, wherein the CCL5 variant comprises a variant N-terminal portion and a C-terminal portion with at least 70% identity to the corresponding portion of wild type CCL5.

Biomarker-based treatment, monitoring, and diagnostic methods for IL-17 dependent conditions, including hidradenitis suppurativa, are disclosed. The biomarkers may be selected from IL6, PLA2G2A, IL19, PI3, CST7, IL17A, IL17F, GH1, MZB1, IL1B, IFNG, TNC, CXCL9, SLAMF7, VEGFA, IL17C, SLAMF1, SDC1, OSM, LBP, REG3A, CD79B, COL4A1, CLEC4D, VWF, IL5RA, CSF3, TGFA, IL2RA, ITIH3, FCAR, CCL23, NRCAM, RETN, SERPINA11, CLEC4G, CSF1, HGF, CRELD2, EFEMP1, LTBR, NME3, CKAP4, CD276, SPON2, GGH, TIMP1, LY9, MCFD2, TCN2, QPCT, HYOU1, TNSFSF13B, CCL2, CCL3, CCL4, CCL5, CCL7, CCL20, CXCL1, CXCL8, PDFGA, CXCR2, CCR6, CXCL13, PCDH1, BOC, MEPE, ADAM23, THOP1, IL1RL2, RCOR1, EDAR, and combinations thereof. Kits for measuring the biomarkers, diagnosing and treating IL-17-dependent conditions, and identifying super-responders are also disclosed.

The invention discloses an application of a substance for detecting a marker group. The application comprises one or more of the following applications: A1) an application in preparation of a product for predicting sensitivity of bicitinib combined with narrow-spectrum medium-wave ultraviolet rays in treatment of leucoderma, and A2) an application in preparation of a product for predicting sensitivity of bicitinib combined with narrow-spectrum medium-wave ultraviolet rays in treatment of leucoderma; a2) is applied to preparation of a product for screening sensitivity of bicitinib combined with narrow-spectrum medium-wave ultraviolet rays in treatment of leucoderma; a3) in preparation of a product for evaluating sensitivity of bicitinib combined with narrow-spectrum medium-wave ultraviolet rays in treatment of leucoderma; the marker group is composed of CCL5, FGL1, EZR and GAPDH (glyceraldehyde-phosphate dehydrogenase). The invention screens and verifies the plasma and urine biomarker group capable of predicting the sensitivity of treating leucoderma by combining baricitinib with narrow-spectrum medium-wave ultraviolet rays of a subject through ELISA (Enzyme-Linked Immunosorbent Assay), and the plasma and urine biomarker group provided by the invention has higher prediction accuracy, sensitivity and specificity; the individualized treatment of vitiligo can be improved, and good clinical application and popularization prospects are achieved.

The present invention provides a method for the diagnosis in vitro of colon cancer in a subject that comprises (i) determining in a sample isolated from the subject the expression level of at least one gene selected from the list consisting of LNC-TBP-2, CCL5, DENND2B, LRRC52-AS1, and RNF31, (ii) calculating a variable S, wherein S= A +B + C – D – E, and wherein: A is the expression level of gene LNC-TBP-2 when the expression level of gene LNC-TBP-2 is determined in step (i), or is 0 when the expression level of gene LNC-TBP-2 is not determined in step (i); B is the expression level of gene CCL5 when the expression level of gene CCL5 is determined in step (i), or is 0 when the expression level of gene CCL5 is not determined in step (i); C is the expression level of gene DENND2B when the expression level of gene DENND2B is determined in step (i), or is 0 when the expression level of gene DENND2B is not determined in step (i); D is the expression level of gene LRRC52-AS1 when the expression level of gene LRRC52-AS1 is determined in step (i), or 0 when the expression level of gene LRRC52-AS1 is not determined in step (i); and E is the expression level of gene RNF31 when the expression level of gene RNF31 is determined in step (i), or is 0 when the expression level of gene RNF31 is not determined in step (i); and (iii) diagnosing the subject as having colon cancer if S calculated in step (ii) is equal or lower than a corresponding reference value. The present invention also provides the use of LNC-TBP-2, CCL5, DENND2B, LRRC52-AS1, and RNF31 as biomarkers of CRC.

The invention relates to the technical field of biology, and provides a predictive biomarker for treating adverse reactions of tumor patients by using CCL5 as an immune checkpoint inhibitor and application of the predictive biomarker, and the predictive biomarker is the dynamic change of the CCL5 relative to a baseline proportion. The detection kit is used for detecting the proportion of CCL5. The dynamic change refers to the change of the CCL5 proportion before and after the immune checkpoint inhibitor is used; if the dynamic change is greater than or equal to 50% or continuously increased, the immune checkpoint inhibitor causes adverse reaction when treating the tumor patient. According to the method, high-risk patients can be identified through peripheral blood detection before irAEs have obvious clinical manifestations, so that a basis for advanced intervention is provided for clinicians, and the occurrence probability of serious adverse events is reduced.

This disclosure provides a method for treating a cancer patient comprising administering to the patient a therapeutically effective amount of an anti-PD-1 antagonist, for example, an anti-PD-1 or anti-PD-L1 antibody, in combination with an indolamine 2,3-dioxygenase inhibitor, wherein the patient is identified as exhibiting a combined biomarker comprising (a) a high IFNγ inflammatory signature score and (b) a low tryptophan 2,3-dioxygenase 2 (TDO2) gene expression score. The high IFNγ inflammatory signature score is determined by measuring the expression of a panel of IFNγ-related inflammatory genes in a cancer sample obtained from the patient, wherein the gene panel comprises, for example, IFNγ, CXCL10, CXCL9, HLA-DRA, IDO1, and STAT1. In some respects, the gene panel also includes CCR5, CXCL11, GZMA, and PRF1.In some aspects, the genetic panel comprises CXCR6, TIGIT, PD-L1, PD-L2, LAG3, NKG7, PSMB10, CMKLR1, CD8A, IDO1, CCL5, CXCL9, HLA.DQA1, CD276, HLA.DRB1, STAT1, HLA.E and TDO2.

The invention discloses application of a targeted Nup85 inhibitor in preparation of a medicine for preventing or treating hepatocellular carcinoma, and relates to the technical field of biological medicine and tumor immunotherapy. The invention provides an application of a targeted Nup85 inhibitor in preparation of a medicine for preventing or treating hepatocellular carcinoma. The inhibitor prevents and / or treats hepatocellular carcinoma by enhancing CD8 + T cell functions, enhancement of the CD8 + T cell functions is realized by regulating STAT1 / CCL5 / CXCL10 pathways, and Nup85 reduces expression of CCL5 and CXCL10 by inhibiting nuclear translocation of phosphorylated STAT1, so that infiltration and activation of CD8 + T cells are inhibited. The invention discloses an immune escape mechanism that Nup85 inhibits CD8 + T cell infiltration by inhibiting p-STAT1 nuclear translocation and down-regulating CCL5 / CXCL10 expression in liver cancer for the first time, provides a new liver cancer immunotherapy target, and broadens the application of nucleopore protein in tumor immunotherapy; the target Nup85 inhibitor can be obtained through a conventional means, a new clinical application direction of the target Nup85 inhibitor is defined, and the target Nup85 inhibitor has good clinical transformation and development prospects.

The disclosure provides a method for treating a subject afflicted with a cancer comprising administering to the subject a therapeutically effective amount of an anti-PD-1 antagonist, e.g., an anti-PD-1 or anti-PD-L1 antibody, in combination with an indoleamine 2,3-dioxygenase inhibitor, wherein the subject is identified as exhibiting a combined biomarker comprising (a) a high IFNγ inflammatory signature score and (b) a low tryptophan 2,3-dioxygenase 2 (TDO2) gene expression score. The high IFNγ inflammatory signature score is determined by measuring the expression of a panel of IFNγ related inflammatory genes in a cancer sample obtained from the subject, wherein the gene panel comprises, e.g., IFNγ, CXCL10, CXCL9, HLA-DRA, IDO1, and STAT1. In some aspects, the gene panel further comprises CCR5, CXCL11, GZMA, and PRF1. In some aspects, the gene panel comprises CXCR6, TIGIT, PD-L1, PD-L2, LAG3, NKG7, PSMB10, CMKLR1, CD8A, IDO1, CCL5, CXCL9, HLA.DQA1, CD276, HLA.DRB1, STAT1, HLA.E, and TDO2.

The invention provides an establishment method and application of a Zika virus infectious animal model, and belongs to the technical field of biology. According to the invention, ZIKV is inoculated to Toll-like receptor-deleted animals, such that the ZIKV challenging animal model is obtained. After the animal is inoculated with ZIKV, obvious ZIKV load can be detected in blood, liver, spleen, reproductive organ and brain tissue of the animal, moreover, the spleen is obviously swollen, the liver tissue has punctiform necrotic lesion, the splenosome is obviously reduced, and the mRNA level of inflammation related indexes Ccl5, Cxcl1, Isg15 and Isg56 is obviously up-regulated, which indicates that the ZIKV challenge model disclosed by the invention is successfully constructed; the method can be used in related researches such as ZIKV infection mechanism, vaccine research and development, anti-ZIKV drug research and development and the like.

The invention relates to the technical field of genetic engineering and pharmaceutical preparations, in particular to a hydrogel drug delivery system carrying recombinant protein for cancer treatment and a preparation method of the hydrogel drug delivery system, the hydrogel drug delivery system comprises recombinant plasmids, the recombinant plasmids are protein pcDNA3.4-PD1-ECD-CCL5 with an amino acid sequence, and the amino acid sequence of the protein is Pab-CCL5. According to the present invention, the recombinant plasmid can express the fusion protein of PD1-ECD-IgG1 and CCL5-IgG1, and the recombinant protein Pab-CCL5 prepared by using the recombinant plasmid has good anti-tumor effect, can change the immune state of the tumor microenvironment, and can reshape the tumor microenvironment; immune cells expressing CCL5 receptors are recruited, and the anti-tumor immune response of the body is improved; the compound kills tumor cells through multiple mechanisms including innate immunity and adaptive immunity, is a potential candidate drug for treating prostate cancer, breast cancer and PD-L1 expression cancer, and is free of cytotoxicity.

The present disclosure provides a clinically applicable method to re-balance production of hematopoietic cells in a mammal, including without limitation an aged mammal, by disrupting the CCL5-CCR5 axis.

The application belongs to the technical field of biological medicine, and particularly relates to a binding molecule targeting CCL5 and application of the binding molecule in combination with drugs in treatment of Th2-type inflammation related diseases. The application discloses use of a binding molecule targeting CCL5 or a pharmaceutical composition comprising the binding molecule in preparation of a product having one or more of the following functions: 1) prevention and / or treatment of Th2-type inflammation related diseases; 2) reduction of skin lesion tissue thickness; 3) reduction of clinical score of atopic dermatitis; 4) reduction of scratching behavior; 5) reduction of tissue damage; 6) alleviation of inflammatory reaction and inhibition of expression of inflammatory factors; and 7) reduction of inflammatory cell infiltration. The binding molecule targeting CCL5 or the pharmaceutical composition comprising the binding molecule has important value in prevention and treatment of immune inflammatory diseases such as atopic dermatitis, allergic rhinitis, asthma, food allergy or drug allergy.

The present disclosure relates to a composition for promoting the activation of bone marrow-derived stem cells, including C-C motif chemokine ligand 5 (CCL5), wherein, when CCL5 is administered together with growth-related oncogene beta (GROβ) and AMD3100, it not only increases the migration of hematopoietic stem cells from bone marrow to peripheral blood, but also enhances the engraftment efficiency when the hematopoietic stem cells are transplanted into recipients.

Biomarker-based treatment, monitoring, and diagnostic methods for IL-17 dependent conditions, including hidradenitis suppurativa, are disclosed. The biomarkers may be selected from IL6, PLA2G2A, IL19, PI3, CST7, IL17A, IL17F, GH1, MZB1, IL1B, IFNG, TNC, CXCL9, SLAMF7, VEGFA, IL17C, SLAMF1, SDC1, OSM, LBP, REG3A, CD79B, COL4A1, CLEC4D, VWF, IL5RA, CSF3, TGFA, IL2RA, ITIH3, FCAR, CCL23, NRCAM, RETN, SERPINA11, CLEC4G, CSF1, HGF, CRELD2, EFEMP1, LTBR, NME3, CKAP4, CD276, SPON2, GGH, TIMP1, LY9, MCFD2, TCN2, QPCT, HYOU1, TNSFSF13B, CCL2, CCL3, CCL4, CCL5, CCL7, CCL20, CXCL1, CXCL8, PDFGA, CXCR2, CCR6, CXCL13, PCDH1, BOC, MEPE, ADAM 23, THOP1, IL1RL2, RCOR1, EDAR, and combinations thereof. Kits for measuring the biomarkers, diagnosing and treating IL-17-dependent conditions, and identifying super-responders are also disclosed.

The invention relates to a marker and a prediction model for predicting the shunt operation curative effect of an idiopathic normal pressure hydrocephalus patient and application of the marker and the prediction model, and belongs to the technical field of biological detection. The marker combination disclosed by the invention comprises genes IFN gamma, IL-1beta, IL-6, TNF-alpha, CCL3, CCL4, CCL5, CXCL16, GZMB and TGF beta. The marker combination provided by the invention is closely related to the prognosis effect of the iNPH, and a prediction model for the shunt operation curative effect of the patient with the idiopathic normal pressure hydrocephalus can be further constructed through the marker combination. The embodiment verifies that when the marker combination is used for predicting the shunt operation curative effect of the idiopathic normal pressure hydrocephalus patient, the sensitivity can reach 100.0%, and the specificity can reach 96.0%.

The invention belongs to the technical field of medicines, and discloses application of IRE1alpha protein or a coding gene thereof as a new target spot for treating hepatitis B virus. The invention reveals for the first time that IRE1alpha protein weakens the recruitment and function of HBV specific CD8 + T cells by promoting macrophages to be polarized to anti-inflammatory phenotypes and inhibiting secretion of chemotactic factors CCL5, and the IRE1alpha protein is a key host factor for maintaining immune tolerance. On the basis, the invention provides an application of a small-molecule inhibitor targeting IRE1alpha in resisting HBV, and provides a new molecular mechanism and a candidate drug for functional healing of HBV.

The current invention is related to the prevention and treatment of diseases including cancer, autoimmune disease, and infectious disease using chemokines and the receptors to which they agonize. It has been found that certain chemokines, including CXCL4, CXCL9, CXCL10, and CXCL12 as well as CCL5 have various effects on toll-like receptors in various cell types and these can be utilized for disease treatment and prevention.

The present invention relates to a method for diagnosing, predicting, predicting susceptibility to treatment, and / or classifying the onset, progression, and / or outcome of diseases or disorders of the female reproductive tract, particularly in the context of endometriosis, wherein the method determines biomarkers in Table 1, such as CCL5 and / or NEAT1. The present invention further relates to a pharmaceutical product for use in patients stratified according to the method of the present invention, and a composition comprising reagents for detecting biomarkers in Table 1 for the diagnosis of diseases or disorders of the female reproductive tract.

The invention relates to a tissue marker for proton radiation heart injury and application of the tissue marker. The tissue marker comprises one or more of a transcription marker and a protein marker. Wherein the transcription marker comprises one or more of PIK3R5, CCR7, IL7R, CD7, CD22, CR2, CCL5 and VAV1, and the transcription marker comprises one or more of PIK3R5, CCR7, IL7R, CD7, CD22, CR2, CCL5 and VAV1; and the protein marker comprises one or more of SIRT1 and HMGB1 (High Mobility Group Box 1). According to the invention, the differential marker is used as a potential biomarker of the radioactive heart loss, and a research method for researching the radioactive heart loss by using a mouse model is provided, so that a demonstrative research is provided for multi-omics analysis of the radioactive heart loss and explanation of an action mechanism of the radioactive heart loss.

The present invention relates to a composition comprising C-C motif chemokine ligand 5 (CCL5) for promoting the activation of bone marrow-derived stem cells. It is identified that, when CCL5, which is a niche-enhancing factor, is injected together with growth related oncogene beta (GROβ), which is known to promote the mobilization of hematopoietic stem cells from the bone marrow into peripheral blood, and AMD3100, which is a CXCR4 antagonist, the migration of hematopoietic stem cells from bone marrow to peripheral blood increases, and the engraftment rate also increases when the hematopoietic stem cells are injected into recipients undergoing bone marrow transplantation. Therefore, the CCL5 protein, GROβ, and the CXCR4 antagonist AMD3100 are provided as a composition for promoting the activation of bone marrow-derived stem cells, and thus bone marrow-derived stem cells activated thereby is provided as a novel therapeutic means for bone marrow diseases requiring bone marrow transplantation.

The invention belongs to the technical field of biological medicines, and particularly relates to application of a PAPSS1 gene in resisting melanoma and colorectal cancer. Based on CRISPR / Cas9 gene editing technology research, PAPSS1 gene deletion is found to significantly up-regulate expression of a chemotactic factor CCL5 by activating an NF-kappa B signal channel, and the effect can be blocked by an NF-kappa B inhibitor JSH-23. Meanwhile, the targeted PAPSS1 can effectively promote infiltration of T cells, especially CD8 + T cells, reverse the immunosuppression state of'immune desert type 'tumors and enhance the tumor immunotherapy effect. According to the application disclosed by the invention, the research for the first time discovers that the knockout of the PAPSS1 can effectively inhibit the growth of melanoma and colorectal malignant tumors, and reveals that the PAPSS1 has important significance on the treatment of melanoma and colorectal cancer by regulating and controlling an immune escape mechanism mediated by a chemotactic factor CCL5-CCR5 axis.

The invention discloses a liposome which is used for inhalation and has chemotactic factor tropism and lung focus microenvironment regulation and control capability. The nano drug delivery system comprises chemotactic factor binding peptide modified on the surface of a liposome and an FGF antagonist entrapped in the liposome, and the chemotactic factor binding peptide is at least one of receptor or binding domain sequences of chemotactic factors related to common lung diseases such as CXCL12, CCL2 and CCL5. The FGF antagonist is at least one of an FGFR tyrosine kinase inhibitor, an antibody targeting FGF or a receptor thereof, an FGF ligand trapping agent and siRNA targeting FGF or the receptor thereof. According to the invention, chemotactic factors enriched in a lung focus microenvironment are utilized to construct the liposome which is used for inhalation and has chemotactic factor tropism, so that regulation and control of the microenvironment are realized, and a new direction is provided for postoperative treatment of breast cancer.

Biomarker-based treatment, monitoring, and diagnostic methods for IL-17 dependent conditions, including hidradenitis suppurativa, are disclosed. The biomarkers may be selected from IL6, PLA2G2A, IL19, PI3, CST7, IL17A, IL17F, GH1, MZB1, IL1B, IFNG, TNC, CXCL9, SLAMF7, VEGFA, IL17C, SLAMF1, SDC1, OSM, LBP, REG3A, CD79B, COL4A1, CLEC4D, VWF, IL5RA, CSF3, TGFA, IL2RA, ITIH3, FCAR, CCL23, NRCAM, RETN, SERPINA11, CLEC4G, CSF1, HGF, CRELD2, EFEMP1, LTBR, NME3, CKAP4, CD276, SPON2, GGH, TIMP1, LY9, MCFD2, TCN2, QPCT, HYOU1, TNSFSF13B, CCL2, CCL3, CCL4, CCL5, CCL7, CCL20, CXCL1, CXCL8, PDFGA, CXCR2, CCR6, CXCL13, PCDH1, BOC, MEPE, ADAM23, THOP1, IL1RL2, RCOR1, EDAR, and combinations thereof. Kits for measuring the biomarkers, diagnosing and treating IL-17-dependent conditions, and identifying super-responders are also disclosed.

This invention relates to the field of biomedicine, specifically to a method for preparing and applying a biomimetic lipoprotein nanodisk to enhance the therapeutic effect on tumors. The method for preparing the biomimetic lipoprotein nanodisk provided by this invention includes the following steps: First, CCL5 peptide and DSPE-PEG2000-mal are dissolved in DMF and triethylamine, stirred at room temperature, and then the reaction solution is purified by dialysis and freeze-dried to obtain a white solid powder; then, methanol is placed in a flask, DPPC, DSPE-PEG2000-CCL5, and NG are dissolved in methanol, acetic acid is added, and the mixture is evaporated to dryness to form a thin film in the flask; then, the film is dispersed with ultrapure water, sonicated with a probe in an ice bath, and then ApoA1 peptide is added to the mixed solution, followed by thermal cycling to obtain C-LNG. This invention optimizes and modifies gemcitabine, developing a new drug NG, which significantly improves the therapeutic effect on tumors, and C-LNG has extremely high targeting and drug loading rates, further enhancing the drug's efficacy.

The application belongs to the technical field of biological medicine, and relates to a BCLAF1 protein Ser564 site phosphorylation antigen peptide, a specific antibody and a preparation method and application thereof. The application identifies BCLAF1 protein Ser564 as a key phosphorylation site through SIK2 kinase screening, and designs and synthesizes a phosphorylation antigen peptide based on the site. After immunizing animals, a polyclonal antibody specifically recognizing BCLAF1 Ser564 site phosphorylation modification is successfully prepared. The antibody has high sensitivity and strong specificity, is suitable for various detection platforms such as immunohistochemistry and immunoblotting, and can be used for evaluating tumor immunotherapy efficacy. The application provides a key tool for analyzing BCLAF1 phosphorylation regulation mechanism, and lays a theoretical foundation for developing an immune combined therapy strategy targeting a SIK2-BCLAF1-CCL5 axis.

The invention relates to the technical field of gene inhibitors, in particular to an RAB7B gene inhibitor and application of the RAB7B gene inhibitor in preparation of drugs for preventing and / or treating echinococcosis. The invention discloses the application of the RAB7B gene inhibitor in the aspects of prevention and treatment of echinococcosis for the first time, and experiments prove that the expression of the RAB7B gene can be remarkably up-regulated by echinococcosis cyst fluid, the EGFR (epidermal growth factor receptor) level can be increased after the echinococcosis cyst fluid interferes with the RAB7B gene, and the inflammatory response of macrophages is promoted along with the remarkable increase of inflammation-related factors (CCL5, IFN-beta and IL-6) in the macrophages. Based on the discovery, the invention provides a treatment strategy for enhancing the host anti-hydatid immune response by inhibiting RAB7B gene expression, and provides a new target and a new drug development direction for immunotherapy of echinococcosis.

The invention relates to the field of medical treatment, and discloses a marker combination for predicting the death risk of a sepsis patient during hospitalization and application. The marker combination comprises six T cell subgroups / functional states related to sepsis specificity, and the six T cell subgroups / functional states comprise Treg-FOXP3 + CTLA4 + IL2RA +; the TM is CD8 + Tem-FGFBP2; nKT CCL5 < + > GNLY < + >; the preparation method comprises the following steps of: performing Thelper22-AHR; the method comprises the following steps of: adding a CD8A + Teffector-GZMK; the invention relates to a CD8A + Tem-GZMK cell subset. Six marker genomes of T cell subgroups / functional states obtained through screening have OER specificity at different time points of sepsis patients, the six T cell subgroups / functional states can serve as a set of T cell subgroups related to sepsis specificity, and the T cell subgroups have high application value in sepsis immunotherapy.

The application discloses CD147-shRNA and application thereof in preparation of immunotherapy drugs, a base sequence of the shRNA is GCAATCACCAATAGCACTGAA; the shRNA sequence for silencing CD147 gene expression is cloned into a lentivirus vector to obtain a recombinant lentivirus particle containing the shRNA sequence, and a recombinant lentivirus for silencing CD147 expression is constructed; the obtained recombinant lentivirus is used for infecting tumor cells to realize the purpose of silencing CD147 gene expression. The shRNA sequence can significantly inhibit the expression of CD147 gene mRNA and protein levels in melanoma and lung cancer cells, increase the expression of chemotactic factor CCL5 and lymphocyte chemotaxis in vitro, increase the number of tumor infiltrating lymphocytes in vivo, inhibit tumor growth, and synergistically enhance the efficacy of immunotherapy for inhibiting tumor growth.

The invention belongs to the technical field of biological medicines, and relates to a BCLAF1 protein Ser564 site phosphorylated antigen peptide, a specific antibody, and a preparation method and an application of the BCLAF1 protein Ser564 site phosphorylated antigen peptide. According to the invention, a BCLAF1 protein Ser564 is screened and identified as a key phosphorylation site through SIK2 kinase, a phosphorylation antigen peptide is designed and synthesized based on the site, and after an animal is immunized, a polyclonal antibody capable of specifically recognizing phosphorylation modification of the BCLAF1 Ser564 site is successfully prepared. The antibody has high sensitivity and strong specificity, is suitable for various detection platforms of immunohistochemistry, immunoblotting and the like, and can be used for evaluating the curative effect of tumor immunotherapy. According to the invention, a key tool is provided for analyzing a BCLAF1 phosphorylation regulation mechanism, and a theoretical basis is laid for developing an immune combination therapy strategy of a targeted SIK2-BCLAF1-CCL5 axis.