19 results about "CCL5" patented technology

The invention relates to the technical field of biology, and provides a predictive biomarker for treating adverse reactions of tumor patients by using CCL5 as an immune checkpoint inhibitor and application of the predictive biomarker, and the predictive biomarker is the dynamic change of the CCL5 relative to a baseline proportion. The detection kit is used for detecting the proportion of CCL5. The dynamic change refers to the change of the CCL5 proportion before and after the immune checkpoint inhibitor is used; if the dynamic change is greater than or equal to 50% or continuously increased, the immune checkpoint inhibitor causes adverse reaction when treating the tumor patient. According to the method, high-risk patients can be identified through peripheral blood detection before irAEs have obvious clinical manifestations, so that a basis for advanced intervention is provided for clinicians, and the occurrence probability of serious adverse events is reduced.

This disclosure provides a method for treating a cancer patient comprising administering to the patient a therapeutically effective amount of an anti-PD-1 antagonist, for example, an anti-PD-1 or anti-PD-L1 antibody, in combination with an indolamine 2,3-dioxygenase inhibitor, wherein the patient is identified as exhibiting a combined biomarker comprising (a) a high IFNγ inflammatory signature score and (b) a low tryptophan 2,3-dioxygenase 2 (TDO2) gene expression score. The high IFNγ inflammatory signature score is determined by measuring the expression of a panel of IFNγ-related inflammatory genes in a cancer sample obtained from the patient, wherein the gene panel comprises, for example, IFNγ, CXCL10, CXCL9, HLA-DRA, IDO1, and STAT1. In some respects, the gene panel also includes CCR5, CXCL11, GZMA, and PRF1.In some aspects, the genetic panel comprises CXCR6, TIGIT, PD-L1, PD-L2, LAG3, NKG7, PSMB10, CMKLR1, CD8A, IDO1, CCL5, CXCL9, HLA.DQA1, CD276, HLA.DRB1, STAT1, HLA.E and TDO2.

The disclosure provides a method for treating a subject afflicted with a cancer comprising administering to the subject a therapeutically effective amount of an anti-PD-1 antagonist, e.g., an anti-PD-1 or anti-PD-L1 antibody, in combination with an indoleamine 2,3-dioxygenase inhibitor, wherein the subject is identified as exhibiting a combined biomarker comprising (a) a high IFNγ inflammatory signature score and (b) a low tryptophan 2,3-dioxygenase 2 (TDO2) gene expression score. The high IFNγ inflammatory signature score is determined by measuring the expression of a panel of IFNγ related inflammatory genes in a cancer sample obtained from the subject, wherein the gene panel comprises, e.g., IFNγ, CXCL10, CXCL9, HLA-DRA, IDO1, and STAT1. In some aspects, the gene panel further comprises CCR5, CXCL11, GZMA, and PRF1. In some aspects, the gene panel comprises CXCR6, TIGIT, PD-L1, PD-L2, LAG3, NKG7, PSMB10, CMKLR1, CD8A, IDO1, CCL5, CXCL9, HLA.DQA1, CD276, HLA.DRB1, STAT1, HLA.E, and TDO2.

The present disclosure provides a clinically applicable method to re-balance production of hematopoietic cells in a mammal, including without limitation an aged mammal, by disrupting the CCL5-CCR5 axis.

The application belongs to the technical field of biological medicine, and particularly relates to a binding molecule targeting CCL5 and application of the binding molecule in combination with drugs in treatment of Th2-type inflammation related diseases. The application discloses use of a binding molecule targeting CCL5 or a pharmaceutical composition comprising the binding molecule in preparation of a product having one or more of the following functions: 1) prevention and / or treatment of Th2-type inflammation related diseases; 2) reduction of skin lesion tissue thickness; 3) reduction of clinical score of atopic dermatitis; 4) reduction of scratching behavior; 5) reduction of tissue damage; 6) alleviation of inflammatory reaction and inhibition of expression of inflammatory factors; and 7) reduction of inflammatory cell infiltration. The binding molecule targeting CCL5 or the pharmaceutical composition comprising the binding molecule has important value in prevention and treatment of immune inflammatory diseases such as atopic dermatitis, allergic rhinitis, asthma, food allergy or drug allergy.

The present disclosure relates to a composition for promoting the activation of bone marrow-derived stem cells, including C-C motif chemokine ligand 5 (CCL5), wherein, when CCL5 is administered together with growth-related oncogene beta (GROβ) and AMD3100, it not only increases the migration of hematopoietic stem cells from bone marrow to peripheral blood, but also enhances the engraftment efficiency when the hematopoietic stem cells are transplanted into recipients.

The invention relates to a marker and a prediction model for predicting the shunt operation curative effect of an idiopathic normal pressure hydrocephalus patient and application of the marker and the prediction model, and belongs to the technical field of biological detection. The marker combination disclosed by the invention comprises genes IFN gamma, IL-1beta, IL-6, TNF-alpha, CCL3, CCL4, CCL5, CXCL16, GZMB and TGF beta. The marker combination provided by the invention is closely related to the prognosis effect of the iNPH, and a prediction model for the shunt operation curative effect of the patient with the idiopathic normal pressure hydrocephalus can be further constructed through the marker combination. The embodiment verifies that when the marker combination is used for predicting the shunt operation curative effect of the idiopathic normal pressure hydrocephalus patient, the sensitivity can reach 100.0%, and the specificity can reach 96.0%.

The invention belongs to the technical field of medicines, and discloses application of IRE1alpha protein or a coding gene thereof as a new target spot for treating hepatitis B virus. The invention reveals for the first time that IRE1alpha protein weakens the recruitment and function of HBV specific CD8 + T cells by promoting macrophages to be polarized to anti-inflammatory phenotypes and inhibiting secretion of chemotactic factors CCL5, and the IRE1alpha protein is a key host factor for maintaining immune tolerance. On the basis, the invention provides an application of a small-molecule inhibitor targeting IRE1alpha in resisting HBV, and provides a new molecular mechanism and a candidate drug for functional healing of HBV.

The present invention relates to a method for diagnosing, predicting, predicting susceptibility to treatment, and / or classifying the onset, progression, and / or outcome of diseases or disorders of the female reproductive tract, particularly in the context of endometriosis, wherein the method determines biomarkers in Table 1, such as CCL5 and / or NEAT1. The present invention further relates to a pharmaceutical product for use in patients stratified according to the method of the present invention, and a composition comprising reagents for detecting biomarkers in Table 1 for the diagnosis of diseases or disorders of the female reproductive tract.

The invention relates to a tissue marker for proton radiation heart injury and application of the tissue marker. The tissue marker comprises one or more of a transcription marker and a protein marker. Wherein the transcription marker comprises one or more of PIK3R5, CCR7, IL7R, CD7, CD22, CR2, CCL5 and VAV1, and the transcription marker comprises one or more of PIK3R5, CCR7, IL7R, CD7, CD22, CR2, CCL5 and VAV1; and the protein marker comprises one or more of SIRT1 and HMGB1 (High Mobility Group Box 1). According to the invention, the differential marker is used as a potential biomarker of the radioactive heart loss, and a research method for researching the radioactive heart loss by using a mouse model is provided, so that a demonstrative research is provided for multi-omics analysis of the radioactive heart loss and explanation of an action mechanism of the radioactive heart loss.

The present invention relates to a composition comprising C-C motif chemokine ligand 5 (CCL5) for promoting the activation of bone marrow-derived stem cells. It is identified that, when CCL5, which is a niche-enhancing factor, is injected together with growth related oncogene beta (GROβ), which is known to promote the mobilization of hematopoietic stem cells from the bone marrow into peripheral blood, and AMD3100, which is a CXCR4 antagonist, the migration of hematopoietic stem cells from bone marrow to peripheral blood increases, and the engraftment rate also increases when the hematopoietic stem cells are injected into recipients undergoing bone marrow transplantation. Therefore, the CCL5 protein, GROβ, and the CXCR4 antagonist AMD3100 are provided as a composition for promoting the activation of bone marrow-derived stem cells, and thus bone marrow-derived stem cells activated thereby is provided as a novel therapeutic means for bone marrow diseases requiring bone marrow transplantation.

Biomarker-based treatment, monitoring, and diagnostic methods for IL-17 dependent conditions, including hidradenitis suppurativa, are disclosed. The biomarkers may be selected from IL6, PLA2G2A, IL19, PI3, CST7, IL17A, IL17F, GH1, MZB1, IL1B, IFNG, TNC, CXCL9, SLAMF7, VEGFA, IL17C, SLAMF1, SDC1, OSM, LBP, REG3A, CD79B, COL4A1, CLEC4D, VWF, IL5RA, CSF3, TGFA, IL2RA, ITIH3, FCAR, CCL23, NRCAM, RETN, SERPINA11, CLEC4G, CSF1, HGF, CRELD2, EFEMP1, LTBR, NME3, CKAP4, CD276, SPON2, GGH, TIMP1, LY9, MCFD2, TCN2, QPCT, HYOU1, TNSFSF13B, CCL2, CCL3, CCL4, CCL5, CCL7, CCL20, CXCL1, CXCL8, PDFGA, CXCR2, CCR6, CXCL13, PCDH1, BOC, MEPE, ADAM23, THOP1, IL1RL2, RCOR1, EDAR, and combinations thereof. Kits for measuring the biomarkers, diagnosing and treating IL-17-dependent conditions, and identifying super-responders are also disclosed.

This invention relates to the field of biomedicine, specifically to a method for preparing and applying a biomimetic lipoprotein nanodisk to enhance the therapeutic effect on tumors. The method for preparing the biomimetic lipoprotein nanodisk provided by this invention includes the following steps: First, CCL5 peptide and DSPE-PEG2000-mal are dissolved in DMF and triethylamine, stirred at room temperature, and then the reaction solution is purified by dialysis and freeze-dried to obtain a white solid powder; then, methanol is placed in a flask, DPPC, DSPE-PEG2000-CCL5, and NG are dissolved in methanol, acetic acid is added, and the mixture is evaporated to dryness to form a thin film in the flask; then, the film is dispersed with ultrapure water, sonicated with a probe in an ice bath, and then ApoA1 peptide is added to the mixed solution, followed by thermal cycling to obtain C-LNG. This invention optimizes and modifies gemcitabine, developing a new drug NG, which significantly improves the therapeutic effect on tumors, and C-LNG has extremely high targeting and drug loading rates, further enhancing the drug's efficacy.

The application belongs to the technical field of biological medicine, and relates to a BCLAF1 protein Ser564 site phosphorylation antigen peptide, a specific antibody and a preparation method and application thereof. The application identifies BCLAF1 protein Ser564 as a key phosphorylation site through SIK2 kinase screening, and designs and synthesizes a phosphorylation antigen peptide based on the site. After immunizing animals, a polyclonal antibody specifically recognizing BCLAF1 Ser564 site phosphorylation modification is successfully prepared. The antibody has high sensitivity and strong specificity, is suitable for various detection platforms such as immunohistochemistry and immunoblotting, and can be used for evaluating tumor immunotherapy efficacy. The application provides a key tool for analyzing BCLAF1 phosphorylation regulation mechanism, and lays a theoretical foundation for developing an immune combined therapy strategy targeting a SIK2-BCLAF1-CCL5 axis.

The invention relates to the technical field of gene inhibitors, in particular to an RAB7B gene inhibitor and application of the RAB7B gene inhibitor in preparation of drugs for preventing and / or treating echinococcosis. The invention discloses the application of the RAB7B gene inhibitor in the aspects of prevention and treatment of echinococcosis for the first time, and experiments prove that the expression of the RAB7B gene can be remarkably up-regulated by echinococcosis cyst fluid, the EGFR (epidermal growth factor receptor) level can be increased after the echinococcosis cyst fluid interferes with the RAB7B gene, and the inflammatory response of macrophages is promoted along with the remarkable increase of inflammation-related factors (CCL5, IFN-beta and IL-6) in the macrophages. Based on the discovery, the invention provides a treatment strategy for enhancing the host anti-hydatid immune response by inhibiting RAB7B gene expression, and provides a new target and a new drug development direction for immunotherapy of echinococcosis.

The application discloses CD147-shRNA and application thereof in preparation of immunotherapy drugs, a base sequence of the shRNA is GCAATCACCAATAGCACTGAA; the shRNA sequence for silencing CD147 gene expression is cloned into a lentivirus vector to obtain a recombinant lentivirus particle containing the shRNA sequence, and a recombinant lentivirus for silencing CD147 expression is constructed; the obtained recombinant lentivirus is used for infecting tumor cells to realize the purpose of silencing CD147 gene expression. The shRNA sequence can significantly inhibit the expression of CD147 gene mRNA and protein levels in melanoma and lung cancer cells, increase the expression of chemotactic factor CCL5 and lymphocyte chemotaxis in vitro, increase the number of tumor infiltrating lymphocytes in vivo, inhibit tumor growth, and synergistically enhance the efficacy of immunotherapy for inhibiting tumor growth.

The invention belongs to the technical field of biological medicines, and relates to a BCLAF1 protein Ser564 site phosphorylated antigen peptide, a specific antibody, and a preparation method and an application of the BCLAF1 protein Ser564 site phosphorylated antigen peptide. According to the invention, a BCLAF1 protein Ser564 is screened and identified as a key phosphorylation site through SIK2 kinase, a phosphorylation antigen peptide is designed and synthesized based on the site, and after an animal is immunized, a polyclonal antibody capable of specifically recognizing phosphorylation modification of the BCLAF1 Ser564 site is successfully prepared. The antibody has high sensitivity and strong specificity, is suitable for various detection platforms of immunohistochemistry, immunoblotting and the like, and can be used for evaluating the curative effect of tumor immunotherapy. According to the invention, a key tool is provided for analyzing a BCLAF1 phosphorylation regulation mechanism, and a theoretical basis is laid for developing an immune combination therapy strategy of a targeted SIK2-BCLAF1-CCL5 axis.

The invention discloses application of a maravil and CCL5 neutralizing antibody to treatment of sepsis-related encephalopathy, and belongs to the field of medicinal chemistry. In-vivo experiments prove the novel application of the CCR5 antagonist malaviif and the CCL5 neutralizing antibody in treatment of sepsis-related encephalopathy (SAE), the survival rate of sepsis mice can be remarkably increased to 60% or above from about 30%, and anxiety-like behaviors and learning and memory dysfunctions of the mice can be effectively improved; according to the core mechanism, by inhibiting CCL5-CCR5 signal channels, pathological damage of hippocampal neurons is relieved, the level of key neuroinflammatory factors (IL-6, IL-1beta, CD68 and HMBG-1) is reduced, and by protecting dendritic spine density and synaptic related protein expression, abnormal synaptic phagocytosis of microglia is inhibited, so that comprehensive protection on the structures and functions of nerve synapses is achieved, and the application prospect is wide. And a verified brand-new target spot and an effective strategy are provided for clinical SAE treatment.

The invention discloses a biomarker and application thereof in predicting CAR-T (Chimeric Antigen Receptor-T) treatment prognosis of a patient with invasive B-cell lymphoma. The biomarker is a cell factor CCL5 and / or TRAIL (Tumor Random Amplified Interleukin) and / or SCGF-beta. It is found for the first time that the expression levels of the cytokines CCL5, TRAIL and SCGF-beta in the blood of the invasive B-cell lymphoma patient are related to prognosis, the difference has statistical significance, and the bad prognosis risk can be effectively predicted by detecting the expression levels of the cytokines CCL5, TRAIL and SCGF-beta in the blood of the invasive B-cell lymphoma patient. It is verified that CCL5, TRAIL and SCGF-beta serving as biomarkers for predicting high-risk prognosis have high accuracy, specificity and sensitivity, and therefore the CCL5, the TRAIL and the SCGF-beta can serve as detection targets to be applied to prognosis analysis of patients with invasive B-cell lymphoma and have good application value.