16 results about "Crohn disease" patented technology

The invention belongs to the technical field of biology, and relates to application of ZEB1 in analysis and treatment of Crohn disease related diseases. Specifically, the invention discloses application of a reagent for detecting the expression level of ZEB1 in preparation of a product for analyzing the severity of Crohn's disease and the risk and severity of intestinal fibrosis stenosis, and application of ZEB1 in preparation of an animal model of Crohn's disease complicated with intestinal fibrosis or DNBS chronic colitis complicated with intestinal fibrosis, and application of ZEB1 in preparation of an animal model of Crohn's disease complicated with intestinal fibrosis or DNBS chronic colitis complicated with intestinal fibrosis. The reagent for inhibiting ZEB1 expression is applied to preparation of products for inhibiting Crohn's disease complicated with intestinal fibrosis or stenosis. The invention determines that ZEB1 can be used as a biomarker of intestinal fibrosis of Crohn's disease, the expression level of ZEB1 is associated with the risk and severity of intestinal fibrosis or intestinal fibrosis stenosis complicated by Crohn's disease, and a new method is provided for clinically evaluating the risk and severity of disease. Meanwhile, it is clear that ZEB1 can be used as a target spot for treating Crohn's disease complicated with intestinal fibrosis or intestinal fibrosis stenosis.

This disclosure relates to compounds of formula I (wherein X and R1-R4, n and m have the meanings set forth herein) and pharmaceutically acceptable salts thereof. Compounds of formula I exhibit GPR183 antagonist activity and are therefore useful in the treatment or prevention of disorders, conditions or diseases for which GPR183 antagonists have been shown to be useful, such as chronic pain, e.g., osteoarthritis, chronic low back pain, neuropathic pain, and immune system disorders, e.g., inflammatory bowel diseases such as colitis and Crohn's disease, multiple sclerosis, rheumatoid arthritis, inflammatory lung diseases, e.g., asthma, and psoriasis. TIFF2026522963000085.tif2570

The present disclosure relates to methods, uses, and compositions (e.g., articles of manufacture and kits) comprising anti-OSMR [beta] antibodies, such as wealizumab, for the treatment of inflammatory gastrointestinal diseases (e.g., inflammatory bowel disease (IBD) (e.g., ulcerative colitis (UC (e.g., moderate to severe UC)) and Crohn's disease (CD)) associated with the oncostatin M (OSM) pathway.

The application belongs to the technical field of biological medicine, and specifically discloses application of a reagent for detecting a tsRNA molecular marker in intestinal mucosa tissue in preparation of a Crohn's disease diagnosis kit, characterized in that the tsRNA molecular marker is tRF-28-PW5SVP9N1503, and the sequence is GCCGTGATCGTATAGTGGTTAGTACTCT; the reagent for detecting the tsRNA molecular marker in intestinal mucosa tissue comprises tRF-28-PW5SVP9N1503 fluorescent quantitative PCR upper and lower stream primers, the upper stream primer is AATGCCGTGATCGTATAGTGGTT, and the lower stream primer is TATCCTTGTTGACGACTGGTTGAC; and the reagent has the advantages that absolute quantitative detection of the target molecule can be quickly and accurately completed only by using a small amount of sample, the reagent is used for early screening and identification of Crohn's disease, and has high sensitivity and strong specificity.

The present application discloses diagnostic methods and kits for detecting disease activity in a subject having an inflammatory bowel disease, such as Crohn's disease. Methods of treating endoscopically active gastrointestinal disease, as well as methods of determining effectiveness of a treatment for endoscopically active gastrointestinal disease in a subject, are also disclosed.

The invention relates to the technical field of cell biology, in particular to a construction method of children Crohn's disease intestinal tract organoid. According to the invention, a natural immune microenvironment is established by using intestinal tissues from children patients suffering from Crohn's disease and immune cells residing in the tissues, so that the experimental limitation of insufficient peripheral blood volume of children is avoided; p-nitro branstatin is innovatively introduced into a culture system, so that the formation of organoid is effectively increased. Compared with the traditional inhibitor blebbistatin of NMII, the p-nitro branstatin has the advantages that the defects of poor solubility and poor light stability are avoided, the composition stability of the culture medium is favorably maintained, and the p-nitro branstatin is more suitable for a system which is a gas-liquid type organ and is longer in liquid change interval and needs to be cultured for a long time. The invention provides a new model for exploration of related mechanisms of children Crohn's disease and evaluation of drug efficacy.

The application discloses a kind of single-cell transcriptome analysis methods and application of Crohn's disease creeping fat microenvironment, belong to the field of biological medicine technology.The method is by obtaining the single-cell and batch transcriptome data of mesenteric adipose tissue of Crohn's disease patient and healthy control, constructs relevant gene set and carries out data quality control, clustering and cell annotation;Mesenchymal stem cells are subpopulation identified, abundance analysis and function typing, combined with signal path analysis and cell communication analysis, and the key factor of regulating creeping fat microenvironment is screened out.The application first systematically analyzes the cell heterogeneity and MSC subpopulation characteristics of Crohn's disease creeping fat microenvironment, and determines the key signal path and regulating molecule, which can provide efficient and reliable technical means for the pathogenesis research, treatment target screening and creeping fat related molecule identification of Crohn's disease, and has high scientific research and clinical application value.

The present invention relates to the prophylactic and / or therapeutic treatment of a disease selected from the group consisting of long-term COVID disease, myalgic encephalomyelitis / chronic fatigue syndrome (ME / CFS) disease, fibromyalgia, dementia, neoplastic disease, autoimmune disease, schizophrenia, epileptic seizure disease, excessive inflammatory disease, chronic inflammatory bowel disease, rheumatic disease, obesity, and the like. Hyperuricemia, diabetes (IDDM / NIDDM), acute viral diseases, amyotrophic lateral sclerosis (ALS), bronchial asthma, atopic allergic disorders, attention deficit disorder (ADD), attention deficit hyperactivity disorder (ADHD), autism spectrum disorders, autoimmune diseases / antibody-related diseases, bipolar affective disorders, celiac disease (CD), chronic obstructive pulmonary disease (COPD), and the like. Chronic inflammatory bowel disease (CED) (i.e. Crohn's disease, ulcerative colitis), cystic fibrosis / cystic fibrosis, depression, endometriosis, polycystic ovarian syndrome, eating disorders, anxiety disorders, addiction disorders, frontotemporal dementia (Pickk's disease), Graves's disease (GD), generalized cardiovascular diseases, Alzheimer's disease, Parkinson's disease, meningitis, multiple sclerosis (MS), and the like. Muscular dystrophy, neurodermatitis, peripheral arterial occlusion disease (PAOD), pneumonia, generalized post-vaccination syndrome and vaccine damage, post-viral infection syndrome, psoriasis, pulmonary arterial hypertension, restless leg syndrome, restrictive pulmonary disease, rheumatoid arthritis (RA), division affective disorder, sepsis, sicca syndrome (SS), scleroderma, and the like. Systemic lupus erythematosus (SLE) and unsatisfactory fertility desires, using an active agent having a nicotinic acetylcholinergic agonist and / or an active agent having a muscarinic acetylcholinergic agonist and / or a muscarinic acetylcholinergic antagonist. This provides a very effective prophylactic and / or therapeutic treatment for these diseases. This prevention or treatment is also readily tolerable, cost effective and easy to apply.

The invention belongs to the technical field of biological medicine, and particularly discloses application of a reagent for detecting a tsRNA molecular marker in intestinal mucosa tissue to preparation of a Crohn disease diagnostic kit, the reagent is characterized in that the tsRNA molecular marker is tRF-28-PW5SVP9N1503, the sequence of the tsRNA molecular marker is GCCGTGATAGTGGTTAGTACTCT, the reagent for detecting the tsRNA molecular marker in the intestinal mucosa tissue comprises tRF-28-PW5SVP9N1503 fluorescent quantitative PCR upstream and downstream primers, and the primer sequence of the tsRNA molecular marker in the intestinal mucosa tissue is shown in the description. The upstream primer is AATG CCGTGATCGTATAGTGGTT, and the downstream primer is TATCCTTGTTGACGACTGGTTGAC, and the downstream primer is The method has the advantages that absolute quantitative detection of target molecules can be rapidly and accurately completed only with a small amount of samples, and the method is used for early screening and identification of Crohn's disease and is high in sensitivity and specificity.

The present invention relates to a computer-implemented method capable of automatically detecting small bowel and colonic ulcers and erosions in Crohn's capsule endoscopy image data, by classifying pixels as lesion or non-lesion, using a convolutional image feature extraction step followed by a classification step and indexing such lesions in the set of one or more classes.

The invention discloses an indoline derivative and application thereof. According to the invention, the regulation effect of the derivative on the chemotaxis and secretion functions of ILC3 is evaluated; it is found that the derivative has a promoting effect on chemotaxis of ILC3 to an inflammatory site and up-regulation of IL-22 expression, has very remarkable effects on mouse ulcerative colitis (UC) induced by DSS, mouse Crohn disease (CD) induced by TNBS, acute lung injury induced by lipopolysaccharide (LPS), mouse psoriasis induced by imiquimod and other diseases in vivo, and is superior to existing clinical treatment drugs. Good development and application prospects are realized.

The invention relates to the technical field of molecular diagnosis, and discloses an extracellular vesicle protein marker for diagnosing inflammatory bowel disease and application, the marker is derived from plasma extracellular vesicle membrane protein and comprises a component I for diagnosing Crohn's disease, a component II for diagnosing ulcerative colitis and a component III for identification. Polymer precipitation is combined with an ultracentrifugation method to extract vesicles, and an antibody oligonucleotide coupling probe and an adjacent bar code analysis technology are utilized to carry out high-throughput detection. According to the marker, the vesicle subgroups are subjected to clustering analysis in combination with a machine learning algorithm, a kit prepared by applying the marker realizes noninvasive screening, early diagnosis and subtype accurate identification of the inflammatory bowel disease by detecting a specific protein combination and an extracellular vesicle subgroup ratio, the problems of diagnosis blind areas and individual heterogeneity of an existing single marker are effectively solved, and the kit has a wide application prospect. The kit has the advantages of high sensitivity, high specificity and non-invasiveness.

The present invention describes methods of diagnosing inflammatory bowel disease, including but not limited to Crohn's Disease (CD), Ulcerative Colitis (UC), and / or Medically Refractive Ulcerative Colitis (MR-UC), using RNASET2, TL1A and / or IFN-γ. The invention further provides a process for patient identification and / or stratification.

This disclosure relates in general to methods for treating, stabilizing, or reducing the severity or slowing the progression of inflammatory bowel disease (IBD), including Crohn's disease (CD) and ulcerative colitis (UC), using an inhibitor of tumor progression site 2 (TPL2) kinase, and pharmaceutical compositions including TPL2 kinase inhibitors used in such methods.

Methods of diagnosing Crohn's disease and ulcerative colitis in subjects is provided based on the determination of metabolites in urine samples, such as serine, hypoxanthine, kynurenine, threonine, indoxylsulfate, phenylacetylglutamine, 5-hydroxy-6-indolyl-O-sulfate, 5-(δ-carboxybutyl) homocysteine, sialic acid, guanidinosuccinic acid (GSA), glutamyl(iso) leucine, trigonelline, cresol sulfate, an anion having m / z: RMT: polarity of 345.1553:0.770: n, aminohippurate: GSA ratiometric biomarker, unknown anion (160.0615:0.830: n): tyrosine ratiometric biomarker and [GSA×Tyr]: [AHA×(an anion having m / z: RMT: polarity of 160.0615:0.830: n)] ratiometric biomarker.

The invention discloses a traditional Chinese medicine composition for treating Crohn disease intestinal fibrosis as well as a preparation method and application of the traditional Chinese medicine composition. The traditional Chinese medicine composition is prepared from the following raw materials in parts by weight: 6-18 parts of codonopsis pilosula, 6-18 parts of bighead atractylodes rhizome, 1-6 parts of coptis chinensis, 9-24 parts of Chinese yam, 9-24 parts of dahurian patrinia herb, 5-15 parts of rhizoma atractylodis, 5-15 parts of pericarpium citri reticulatae, 5-15 parts of lotus plumule, 9-24 parts of red paeony root, 9-24 parts of hairyvein agrimony, 5-15 parts of turtle shell, 5-15 parts of cassia twig, 9-24 parts of poria cocos, 6-18 parts of peach kernel, 5-15 parts of moutan bark, 5-15 parts of dendrobe, 5-15 parts of selaginella tamariscina and 12-30 parts of coix seed. Aiming at the clinical problem of fibrous stenosis formed after inflammation control, the traditional Chinese medicine composition disclosed by the invention adopts a treatment method of tonifying spleen and drying dampness, clearing heat and removing turbidity, promoting blood circulation to remove blood stasis and softening hardness to dissipate stagnation, and is scientific in formula. Network pharmacology prediction and experimental verification show that the compound can regulate and control the fibrosis process in a multi-target manner, remarkably reverse the formed intestinal fibrosis and improve the intestinal elasticity, is good in long-term medication safety, and provides an effective traditional Chinese medicine solution for treating the Crohn disease intestinal fibrosis.