96 results about "Crohn disease" patented technology

The invention features new a method for treating inflammatory bowel disease, including Crohn's Disease (CD) or ulcerative colitis in a human patient, comprising administering to a patient a combination therapy comprising an anti-α4β7 antibody, a TNFα antagonist, and an immunomodulator.

The present disclosure relates to peptide IL23 receptor antagonists, pharmaceutical compositions thereof, and medical uses thereof, e.g., for the treatment of inflammatory bowel disease, such as Crohn's disease.

The invention relates to the field of medical image processing, and discloses a Crohn disease intestinal stenosis type identification method based on radiomics and deep learning, which comprises the following steps: marking a region of interest of an intestinal stenosis section through standardized ultrasonic gray-scale image acquisition, and extracting radiomics features and deep learning features; constructing a classification model based on image omics by using a random forest algorithm, and extracting deep features and constructing a classification model by using a ResNet50 deep learning network; in order to further improve the classification performance, in combination with the results of the radiomics model and the deep learning model, multi-modal classification is realized through weighted fusion; the classification result is used for distinguishing inflammatory stenosis and fibrous stenosis of the intestinal tract of the Crohn's disease. According to the method, the dependence of traditional ultrasonic diagnosis on experience of operators is overcome, the diagnosis consistency and accuracy are remarkably improved, and reliable support is provided for non-invasive accurate diagnosis of the Crohn disease intestinal stenosis type.

The invention discloses application of Gli1 + interstitial cells or SMOC2 protein thereof in diagnosis, treatment and prognosis evaluation of Crohn disease intestinal stenosis. The invention provides application of Gli1 + interstitial cells and SMOC2 protein as targets in preparation of a diagnostic kit or a therapeutic drug for Crohn disease fibrostenosis, and further provides the diagnostic kit for Crohn disease fibrostenosis and the therapeutic drug for Crohn disease fibrostenosis. Meanwhile, the invention further provides application of the reagent for detecting the expression quantity of the SMOC2 in preparation of the kit for evaluating postoperative recurrence of the Crohn disease fibrostenosis and the corresponding kit for evaluating postoperative recurrence of the Crohn disease fibrostenosis. The invention discusses the effect of the Gli1 + interstitial cells in the attack of intestinal fibrostenosis, evaluates the potential of the Gli1 + interstitial cells as a diagnosis and treatment target, and provides a new thought for the treatment of Crohn disease intestinal stenosis.

The invention discloses an intestinal targeted drug delivery composition which sequentially comprises (1) a pellet core and a non-pH dependent sustained-release layer containing an active ingredient, or a pellet containing an active ingredient and a non-pH dependent sustained-release layer, or a pellet containing an active ingredient and a non-pH dependent sustained-release material, (2) a pH dependent coating layer and (3) a time dependent pulse controlled-release layer from inside to outside. The intestinal targeted drug delivery composition delivers the active ingredients to intestinal tissues (especially colon tissues) for release, reduces the whole body blood concentration, and improves the pharmacokinetic characteristics of the active ingredients and the concentration of the active ingredients in the intestinal tissues. The composition is suitable for treating intestinal diseases, such as Crohn's disease, ulcerative colitis and other inflammatory bowel diseases.

The invention discloses a copper ion-luteolin nano-composite and application thereof in treatment of inflammatory bowel disease, the obtained nano-composite has very strong stability and active oxygen scavenging ability, and has excellent anti-oxidation and anti-inflammatory ability, specifically, the nano-composite is negatively charged, can effectively target intestinal inflammation lesion, and can be used for treating inflammatory bowel disease, so that the copper ion-luteolin nano-composite can be applied to treatment of inflammatory bowel disease. Mucosal barrier repair is promoted, intestinal flora is regulated, and the inflammation microenvironment is remarkably regulated; the antioxidant and anti-inflammatory capacities of cells can be enhanced by regulating and controlling an oxidative stress pathway of a nuclear factor erythroid 2 related factor 2 / heme oxygenase-1 (Nrf2 / HO-1) and a nuclear factor kappa B (NF-kappa B) signal pathway; the compound shows a good treatment effect in a typical inflammatory bowel disease mouse model, including ulcerative colitis and Crohn's disease. The invention provides a new way for constructing a multi-layer treatment platform for treating the inflammatory bowel disease by using natural products.

The present disclosure provides methods for assessing mucosal healing in a patient with Crohn's Disease. The methods include detecting expression levels of analytes in a serum sample from a patient, and applying a mathematical algorithm to the expression levels, thereby producing a Mucosal Healing Index score for the patient. The present disclosure also provides kits that include two or more binding partners, each or which is capable of binding a different analyte measured in the disclosed mucosal healing assessment methods.

To provide methods of treating inflammatory bowel diseases (IBD) (e.g., Crohn's disease (CD) or ulcerative colitis (UC)) or alleviating or reducing the risk of relapse of IBD in a subject.SOLUTION: The present invention provides a method for alleviating or reducing the risk of relapse of inflammatory bowel disease (IBD), the method comprising administering to a subject in need thereof an effective amount of a 2'-fucosyllactose compound, wherein the subject is a human IBD patient who has undergone or is on an anti-inflammatory therapy.SELECTED DRAWING: Figure 2

Novel compounds that act as inhibitors of alpha4beta7 integrin are disclosed. Pharmaceutical compositions and methods of use of inhibitors of [alpha] 4 [beta] 7 integrin are disclosed. In particular, methods of using the [alpha] 4 [beta] 7 inhibitors in the treatment of diseases or conditions associated with inflammatory bowel diseases, including ulcerative colitis and Crohn's disease.

This invention relates to the use of Bacillus amyloliquefaciens and / or Bacillus subtilis for the enhancement of active probiotic compositions or for the activation of inactive probiotic compositions for use in the prevention and / or treatment of inflammatory bowel diseases, such as Crohn's disease, ulcerative colitis, indeterminate colitis and microscopic colitis, the compositions thus obtained, and a method for the enhancement of active probiotic compositions or for the activation of inactive probiotic compositions for use in the prevention and / or treatment of inflammatory bowel diseases, such as Crohn's disease, ulcerative colitis, indeterminate colitis and microscopic colitis.

Provided are methods for determining the risk of, diagnosing, preventing, or treating Crohn's Disease (CD), ulcerative colitis (UC) and / or inflammatory bowel disease (IBD) in an individual. Some embodiments provide kits and computer program products for determining the risk of or diagnosing Crohn's Disease (CD), ulcerative colitis (UC) and / or inflammatory bowel disease (IBD) in an individual. Other example embodiments are described herein. In certain embodiments, the disclosed methods and kits are accurate, cost-effective and non-invasive.

This disclosure provides a method for analyzing peripheral blood leukocytes. In some embodiments, method may comprise: (a) labeling peripheral blood leukocytes isolated from a patient that has or is suspected of having inflammatory bowel disease (IBD) with a panel of distinguishably-labeled antibodies and (b) analyzing binding of the antibodies to the peripheral blood leukocytes. Kits for performing the method are also provided. Results from the analysis can be used to make a diagnosis of Crohn's disease or ulcerative colitis.

The present application discloses an intestine-targeted drug delivery composition, comprising in sequence, from inside to outside, (1) a microsphere core and a pH-independent sustained-release layer containing an active ingredient, or a microsphere containing an active ingredient and a pH-independent sustained-release layer, or a microsphere containing an active ingredient and a pH-independent sustained-release material, (2) a pH-dependent coating layer, and (3) a time-dependent pulsatile controlled-release layer. The intestine-targeted drug delivery composition of the present application delivers the active ingredient to intestinal tissues (especially colon tissue) for release, reduces the systemic blood concentration of the active ingredient, and improves the pharmacokinetic characteristics and concentration of the active ingredient in intestinal tissues. The composition is suitable for treating intestinal diseases, such as inflammatory bowel diseases including Crohn's disease and ulcerative colitis.

The present disclosure is directed to methods for treating Crohn's disease, and in particular, to methods for inducing clinical remission and / or endoscopic improvement of Crohn's disease, using a JAK1 inhibitor. In certain embodiments, the patient is administered an induction dose of the JAK1 inhibitor to induce clinical remission and / or endoscopic improvement of the Crohn's disease, followed by administration of at least one maintenance dose of the JAK1 inhibitor thereafter. In other embodiments, the present disclosure is directed to methods for treating ulcerative colitis using a JAK1 inhibitor.

Disclosed herein are C-mannoside compounds, compositions thereof and their application as pharmaceuticals for the treatment of human disease. Methods of inhibition of FimH activity in a human subject are also provided for the treatment of diseases such as bacterial infection, Crohn's disease (CD) and Inflammatory Bowel Disease (IBD).

The present application relates to the field of biomedicine, and more particularly to the use of R-1,3-butanediol in the preparation of a drug for the prevention or treatment of inflammatory bowel disease, wherein the drug for the prevention or treatment of inflammatory bowel disease is a mixture of R-1,3-butanediol and normal saline. R-1,3-butanediol can be used to prepare a drug for the prevention or treatment of inflammatory bowel disease. R-1,3-butanediol has good effects in promoting weight gain in patients with colitis, reducing colon shortening in patients with colitis, reducing disease activity scores in patients with colitis, reducing intestinal histological scores in patients with colitis, promoting mucosal barrier repair in patients with colitis, and inhibiting inflammatory cell infiltration, particularly in the prevention and treatment of ulcerative colitis and Crohn's disease.

The invention belongs to the technical field of biology, and relates to application of ZEB1 in analysis and treatment of Crohn disease related diseases. Specifically, the invention discloses application of a reagent for detecting the expression level of ZEB1 in preparation of a product for analyzing the severity of Crohn's disease and the risk and severity of intestinal fibrosis stenosis, and application of ZEB1 in preparation of an animal model of Crohn's disease complicated with intestinal fibrosis or DNBS chronic colitis complicated with intestinal fibrosis, and application of ZEB1 in preparation of an animal model of Crohn's disease complicated with intestinal fibrosis or DNBS chronic colitis complicated with intestinal fibrosis. The reagent for inhibiting ZEB1 expression is applied to preparation of products for inhibiting Crohn's disease complicated with intestinal fibrosis or stenosis. The invention determines that ZEB1 can be used as a biomarker of intestinal fibrosis of Crohn's disease, the expression level of ZEB1 is associated with the risk and severity of intestinal fibrosis or intestinal fibrosis stenosis complicated by Crohn's disease, and a new method is provided for clinically evaluating the risk and severity of disease. Meanwhile, it is clear that ZEB1 can be used as a target spot for treating Crohn's disease complicated with intestinal fibrosis or intestinal fibrosis stenosis.

This disclosure relates to compounds of formula I (wherein X and R1-R4, n and m have the meanings set forth herein) and pharmaceutically acceptable salts thereof. Compounds of formula I exhibit GPR183 antagonist activity and are therefore useful in the treatment or prevention of disorders, conditions or diseases for which GPR183 antagonists have been shown to be useful, such as chronic pain, e.g., osteoarthritis, chronic low back pain, neuropathic pain, and immune system disorders, e.g., inflammatory bowel diseases such as colitis and Crohn's disease, multiple sclerosis, rheumatoid arthritis, inflammatory lung diseases, e.g., asthma, and psoriasis. TIFF2026522963000085.tif2570

The present disclosure relates to crystalline forms of N-(l-(tert-butyl)-lH-pyrazol-4-yl)-2-( 4-((6-((methylsulfonyl)quinolin-4-yl)oxy)-3-methylphenyl)acetamide of formula (II) and crystalline forms of salts thereof. The compound of formula (II) is a RIPK2 inhibitor for the treatment of e.g. inflammatory diseases, autoimmune diseases, granulomatous disease, neurodegenerative diseases or cancer, and more specifically for the treatment of inflammatory bowel disease, such as Crohn's disease or ulcerative colitis, rheumatoid arthritis, inflammatory arthritis, peritonitis, ischemia reperfusion injury in kidney transplant, non-alcohol steatohepatitis, alcohol steatohepatitis, insulin-resistant type 2 diabetes, allergic rhinitis, asthma, atopic dermatitis, Sjogren's syndrome, spondyloarthritis, ankylosing spondylitis, pemphigus vulgaris, idiopathic plasmacytic lymphadenopathy, atherosclerosis, myocardial infarction, thrombosis, alpha-synucleinopathy, Parkinson's disease, dementia with Lewy body, multiple system atrophy, Alzheimer's disease, amyotrophic lateral sclerosis, and chronic obstructive pulmonary disease

The present disclosure relates to methods, uses, and compositions (e.g., articles of manufacture and kits) comprising anti-OSMR [beta] antibodies, such as wealizumab, for the treatment of inflammatory gastrointestinal diseases (e.g., inflammatory bowel disease (IBD) (e.g., ulcerative colitis (UC (e.g., moderate to severe UC)) and Crohn's disease (CD)) associated with the oncostatin M (OSM) pathway.

The present invention relates to GPR120 agonists for use in the treatment of inflammatory bowel disease, in particular ulcerative colitis or Crohn's disease.

The present disclosure relates generally to methods of using inhibitors of tumor progression locus 2 (TPL2) kinase for treating, stabilizing, or lessening the severity or progression of inflammatory bowel disease (IBD), including Crohn's disease (CD) and ulcerative colitis (UC), and pharmaceutical compositions including TPL2 kinase inhibitors for use in such methods.

The application belongs to the technical field of biological medicine, and specifically discloses application of a reagent for detecting a tsRNA molecular marker in intestinal mucosa tissue in preparation of a Crohn's disease diagnosis kit, characterized in that the tsRNA molecular marker is tRF-28-PW5SVP9N1503, and the sequence is GCCGTGATCGTATAGTGGTTAGTACTCT; the reagent for detecting the tsRNA molecular marker in intestinal mucosa tissue comprises tRF-28-PW5SVP9N1503 fluorescent quantitative PCR upper and lower stream primers, the upper stream primer is AATGCCGTGATCGTATAGTGGTT, and the lower stream primer is TATCCTTGTTGACGACTGGTTGAC; and the reagent has the advantages that absolute quantitative detection of the target molecule can be quickly and accurately completed only by using a small amount of sample, the reagent is used for early screening and identification of Crohn's disease, and has high sensitivity and strong specificity.

The present application discloses diagnostic methods and kits for detecting disease activity in a subject having an inflammatory bowel disease, such as Crohn's disease. Methods of treating endoscopically active gastrointestinal disease, as well as methods of determining effectiveness of a treatment for endoscopically active gastrointestinal disease in a subject, are also disclosed.

The invention relates to the technical field of cell biology, in particular to a construction method of children Crohn's disease intestinal tract organoid. According to the invention, a natural immune microenvironment is established by using intestinal tissues from children patients suffering from Crohn's disease and immune cells residing in the tissues, so that the experimental limitation of insufficient peripheral blood volume of children is avoided; p-nitro branstatin is innovatively introduced into a culture system, so that the formation of organoid is effectively increased. Compared with the traditional inhibitor blebbistatin of NMII, the p-nitro branstatin has the advantages that the defects of poor solubility and poor light stability are avoided, the composition stability of the culture medium is favorably maintained, and the p-nitro branstatin is more suitable for a system which is a gas-liquid type organ and is longer in liquid change interval and needs to be cultured for a long time. The invention provides a new model for exploration of related mechanisms of children Crohn's disease and evaluation of drug efficacy.

Described herein are methods and compositions relating to the inhibition of bile salt hydrolase (BSH) and uses thereof.SOLUTION: Provided herein are methods for treating metabolic disorders (e.g., diabetes, obesity), gastrointestinal diseases (such as gastrointestinal infections; inflammatory bowel diseases (IBD); appendicitis; Crohn's disease (CD); ulcerative cholitis (UC); gastritis; enteritis; esophagitis; pancreatitis; diabetics; hepatits; hepatic diseases (such as non-alcoholic fatty liver disease (NAFLD); non-alcoholic fat hepatits (NASH); hepatits A; hepatits B; hepatits C; autoimmune hepatits; and cirrhosis of the liver); gastroesophageal reflux disease (GERD); celiac disease; diverticulitis; food intolerance; ulcers; infectious colitis; irritable bowel syndromes; intestinal wall leakage; and cancers); Methods for treating cancer (e.g., cancer of the digestive system, liver cancer) or inflammatory diseases (e.g., Crohn's disease, inflammatory bowel disease, ulcerative colitis, pancreatitis, hepatitis, appendicitis, gastritis, diverticulitis, celiac disease, food intolerance, enteritis, ulcers, gastroesophageal reflux disease (GERD), psoriatic arthritis, psoriasis, and rheumatoid arthritis) in a subject in need thereof comprising administering to the subject a compound represented by Formulae (I) - (XVIII).SELECTED DRAWING: None

The result of orally administering saliva derived from a Crohn's disease patient or an ulcerative colitis patient to germ-free mice has revealed that Th1 cells markedly increased in the colons. Further, from the bacterial microbiota in the intestines of the mice in which such an increase in Th1 cells were observed, bacteria have been successfully isolated which caused strong Th1 cell induction in the colon upon intestinal colonization.

Described herein are methods and compositions related to the discovery of associations in TNFSF15 15 and DcR3 genetic loci across in Caucasian, Puerto Rican, and Korean Crohn's Disease, as demonstrated via trans-ethnic fine mapping. The present invention provides methods of quantifying risk and diagnosing susceptibility to Crohn's disease in a subject by determining the presence of one or more risk variants are at the TNF SF15 (or TL1A) and / or DcR3 genetic loci.

The present disclosure provides small molecule compounds and pharmaceutical compositions useful for modulating alpha4beta7 integrin, useful for the treatment of inflammatory disorders, such as inflammatory bowel diseases, including ulcerative colitis and Crohn's disease.

The application discloses a kind of single-cell transcriptome analysis methods and application of Crohn's disease creeping fat microenvironment, belong to the field of biological medicine technology.The method is by obtaining the single-cell and batch transcriptome data of mesenteric adipose tissue of Crohn's disease patient and healthy control, constructs relevant gene set and carries out data quality control, clustering and cell annotation;Mesenchymal stem cells are subpopulation identified, abundance analysis and function typing, combined with signal path analysis and cell communication analysis, and the key factor of regulating creeping fat microenvironment is screened out.The application first systematically analyzes the cell heterogeneity and MSC subpopulation characteristics of Crohn's disease creeping fat microenvironment, and determines the key signal path and regulating molecule, which can provide efficient and reliable technical means for the pathogenesis research, treatment target screening and creeping fat related molecule identification of Crohn's disease, and has high scientific research and clinical application value.