24 results about "Neuronal stem cell" patented technology

The invention discloses a construction method of a high-stability interdigital supercapacitor, and the method comprises the steps: firstly designing the interdigital supercapacitor, and obtaining an interdigital conductive substrate through micromachining; then synthesizing a conductive organic frame nano material with good conductivity, and combining with a conductive polymer PEDOT: PSS to construct a composite flexible nano frame composite layer; by optimizing modification conditions, the composite material is modified on an interdigital conductive substrate, and a novel interdigital supercapacitor is prepared. The result shows that the constructed interdigital supercapacitor still keeps high specific capacitance and high stability after tens of thousands of charging and discharging cycles under different current densities. Based on the high-stability interdigital supercapacitor, a platform for promoting the neural stem cells to differentiate into neurons based on in-situ electrical stimulation is subsequently established in the method: electrical stimulation is continuously and stably applied through the interdigital supercapacitor, so that the differentiation speed of the neural stem cells is remarkably increased; and an effective research tool is provided for research of a basic molecular mechanism of neurodegenerative diseases.

Provided are a preparation method for and a use of a dorsal root ganglion organoid. In one aspect, a preparation method for a dorsal root ganglion organoid is provided, which comprises: (1) inducing stem cells in a neural stem cell induction medium, to obtain neural stem cells; (2) inducing the neural stem cells in a neural crest cell induction medium, to obtain neural crest cells; (3) inducing the neural crest cells in a sensory neural progenitor cell induction medium, to obtain sensory neural progenitor cells; (4) inducing the sensory neural progenitor cells in an organoid induction medium, to obtain a dorsal root ganglion organoid. In addition, a use of the dorsal root ganglion organoid obtained by said method is also provided, for example, for drug screening or disease research.

The present invention relates to a method for efficiently isolating and culturing neural stem cells. This method can simplify the isolation and culturing process, shorten the isolation and culturing time, and increase the yield of neural stem cells. The method comprises the following steps: adding brain tissue to an enzyme solution to enzymatically treat the brain tissue; physically separating cell clusters from the enzymatically treated brain tissue; separating the cell clusters by size and removing impurities; and then seeding the cell clusters onto culture dishes for subculture.

The invention discloses a method for inducing directional differentiation of stem cells by neural factors as well as a preparation and application thereof, and the preparation is a liquid preparation and comprises the following components: BDNF with the concentration of 25-75 ng / mL, GDNF with the concentration of 20-30 ng / mL, NT-3 with the concentration of 5-10 ng / mL and TSA with the concentration of 100-150 nM. The preparation for inducing the directional differentiation of the stem cells through the neural factors can remarkably improve the directional differentiation efficiency of the neural stem cells to neurons, the purity of the neurons is at a high level, the cell viability is good, target cells with mature functions can be efficiently induced, and a new thought is provided for cell treatment of Parkinson's disease.

The invention discloses a nutritional composition for synergistically regulating neural stem cells to differentiate into specific nerve cells. The invention provides a nutritional composition. The nutritional composition comprises the following necessary components: a grease component and a sialic acid oligosaccharide component, moreover, in the nutritional composition, the molar ratio of the grease component to the sialic acid oligosaccharide component is (1-5): (0.01-5). The nutritional composition provided by the invention can effectively promote the neural stem cells to differentiate into specific nerve cells and achieve function maturation, especially significantly promote the neural stem cells to differentiate into neurons, and shows a synergistic enhancement effect on the structure and function aspects, and the components have a synergistic effect.

The invention belongs to the field of biomedical engineering materials, and provides a degradable piezoelectric / conductive cytoskeleton for nerve injury repair, which is prepared according to the following steps: immersing a crosslinked gelatin fiber membrane into excessive graphene oxide liquid, irradiating with ultraviolet light, stirring, and reducing with Na2S2O4. The gelatin fiber membrane with the surface coated with the graphene, which is obtained by the method, can be used for culturing neural stem cells, and the obtained fiber membrane attached with the neural stem cells can be used as a medical engineering material for neural restoration. The graphene and the gelatin fiber are tightly combined to form a continuous phase, so that the conductive performance is excellent, piezoelectric signals generated by the gelatin can be collected and transmitted by the graphene, and more remarkable electric output is generated. The cell scaffold can induce neural differentiation of stem cells in a lead-free mode that electric signals are generated through ultrasonic driving, the risk of infection of external leads is avoided, and the cell scaffold is safer and has remarkable clinical value; and the used materials are gradually degraded in vivo, so that long-term influence in vivo is avoided.

This invention discloses an injectable hydrogel for long-term sustained release of NGF and CNTF, its preparation method, and its application in visual system diseases. The bioactive factor sustained-release hydrogel of this invention comprises a hydrogel matrix and bioactive factor microspheres loaded on the matrix; the raw materials for preparing the hydrogel matrix include chitosan, type II collagen, and hyaluronic acid; the bioactive factor microspheres comprise an inner core and a capsule wall, the inner core being a bioactive factor selected from one or both of ciliary neurotrophic factor and nerve growth factor, and the capsule wall being a polylactic acid-glycolic acid copolymer. This hydrogel can achieve long-term stable release of NTF, activating endogenous neural stem cells in the retina to generate new retinal ganglion cells. It exhibits high safety, good injectability, and a long sustained-release period, and can be used to prepare drugs for treating visual system diseases such as glaucoma, optic nerve damage, and macular degeneration.

The present invention provides a method for preparing 3D brain organoids, comprising the following steps: neurospheres obtained by the RONA method are dissociated into single cells by accutase, plated on a cell culture plate after being counted, cultured in medium A until day 7; neurospheres are cultured in medium B until day 25˜35, and then they are encapsulated by Matrigel; neurospheres are further cultured in media B until day 55˜65, and then they are encapsulated by Matrigel for the second time and cultured continually afterwards. The present invention also provides a medium for culturing 3D brain organoids. The present invention begins with highly purified neurospheres obtained by the RONA method, and neuronal stem cells can be controlled and cultured to achieve true 3D brain organoids with uniform size and structure by this relatively simple method. The 3D brain organoids have six-layered cortical structure of the brain and various subtypes of inhibitory interneuron cells, which are suitable for disease research in vitro, drug screening, etc., and are of great significance in industrialization.

The invention relates to the technical field of monitoring, and discloses a carbon nanotube fiber-based multichannel electrode pool for neural stem cell culture and signal acquisition, the carbon nanotube fiber-based multichannel electrode pool comprises a baffle plate, the upper surface of the baffle plate is provided with a cell culture dish, the cell culture dish is internally provided with a cell culture pool, one side of the cell culture pool is provided with a separator plate, and the separator plate is provided with a carbon nanotube fiber. The upper surface of the baffle plate is provided with a terminal display screen, and the upper surface of the baffle plate is provided with a conductive contact. According to the invention, the electrode adopts the carbon nanotube fiber as a conductive material, the conductivity reaches 1000-1500S / cm, the conductive sensitivity is excellent, and the electric signal characteristics of neural stem cells can be accurately captured; the three conductive contacts arranged at equal intervals are in full contact with cell sap, an electric signal direct transmission mechanism is matched, the data error rate is smaller than or equal to + / -1.2%, compared with a traditional fluorescent dye method and a cell counting method, manual observation and counting errors are greatly reduced, and reliable data support is provided for cell viability evaluation.

The invention relates to a cerebrospinal fluid-rich fibroin hydrogel stent system loaded with neural stem cell exosomes as well as a preparation method and application of the cerebrospinal fluid-rich fibroin hydrogel stent system, in particular relates to cerebrospinal fluid-rich fibroin hydrogel loaded with neural stem cell-derived exosomes to promote repair of neurons after spinal cord injury, and belongs to the technical field of biological medicines. The engineered neural stem cell exosome of the targeted neuronal cells designed by the invention can play roles in improving the local ischemia environment after spinal cord injury, promoting vascular regeneration and inhibiting neuronal aging, and is more beneficial to repair and regeneration of local nerves. The exosome is combined with the fibroin hydrogel rich in cerebrospinal fluid to form an exosome sustained-release system to be applied to local spinal cord injury, so that the treatment efficiency of the exosome is improved, rapid release, large accumulative release amount and long action time are realized, the functional recovery after spinal cord injury is obviously improved, and the exosome has good practical application value.

The invention relates to the technical field of biological medicine, in particular to a neural stem cell for treating Alzheimer's disease and a preparation process, according to the preparation process, separation process optimization, amplification system strengthening and directional differentiation means innovation are performed, and the prepared neural stem cell has the characteristics of high purity, high dryness and high cholinergic differentiation efficiency; the neural stem cells prepared by the process are expected to provide a reliable seed cell source for AD cell therapy.

The invention relates to the technical field of biological medicines, in particular to a method for inducing neural stem cells to differentiate into dopaminergic neurons by a small molecule compound. A magnetic mesoporous silica-phase change liposome composite system is constructed, wherein the surface of a three-dimensional porous bioglass substrate is modified with bifunctional peptide, and a glycogen synthase kinase inhibitor, a transmembrane protease inhibitor and a bone morphogenetic protein receptor antagonist are loaded on the three-dimensional porous bioglass substrate. A response mechanism of a photosensitive cyclic adenylate analogue and a dopamine synthesis precursor is activated through blue light pulses, and finally targeted sorting is completed by a fluorescent tracing substrate, so that a high-purity functional dopaminergic neuron population is obtained. Through physical microenvironment optimization, chemical signal channel regulation and control and multi-dimensional integration of a light-operated maturation mechanism, efficient and controllable differentiation of neural stem cells to dopaminergic neurons is realized, and a standardized preparation scheme is provided for Parkinson's disease cell therapy.

An injectable, self-healing hydrogel, its preparation method, and its applications. This invention belongs to the field of biomedical engineering and neural regeneration, specifically relating to a hydrogel, its preparation method, and its applications. This invention provides an injectable, self-healing hydrogel for carrying neural stem cells based on Schiff base crosslinking. This hydrogel achieves self-healing and injectability through dynamic Schiff base bonds. A reversible imine bond crosslinking structure is formed through the Schiff base reaction between amino and aldehyde groups, exhibiting good biocompatibility and structural stability. The surface of biological tissue is rich in amino and hydroxyl groups, which can react again with the aldehyde groups in the OHA to form a dynamic covalent crosslinking network. Through interfacial Schiff base bonding, electrostatic attraction, and hydrogen bonding, this hydrogel can achieve strong wet adhesion to biological tissue and form a stable scaffold at the site of brain injury. Simultaneously, the nanospheres in the system can achieve sustained release of growth factors, effectively promoting the survival, proliferation, and differentiation of neural stem cells, ultimately achieving precise repair and functional recovery of neural tissue.

The present invention relates to the field of biomedicine, and specifically provides a nucleic acid construct, an engineered pluripotent stem cell prepared from the nucleic acid construct, and a neural stem cell, astrocyte, mesenchymal stem cell, GABAergic nerve cell and DAergic nerve cell obtained by differentiation of the engineered pluripotent stem cell. Further provided is a use of the nucleic acid construct and the various cells in treatment of diseases associated with dopaminergic neuron degeneration and / or damage.

The present invention discloses a multi-layered cell-loaded nerve repair conduit with the functions of conducting electricity, resisting inflammation and promoting nerve differentiation, and a preparation method thereof. The preparation method is as follows: 1) preparing PLGA fibers doped with graphene, weaving them to obtain a layer of cylindrical fiber mesh; 2) preparing a HAMA mixed solution mixed with microspheres loaded with nerve growth factor and manganese dioxide nanoparticles, and a HAMA solution loaded with neural stem cells; 3) fixing the cylindrical fiber mesh in a cylindrical groove mold, pouring the HAMA mixed solution, and freeze-drying after UV curing to obtain a two-layer porous composite scaffold; 4) immersing it in the HAMA solution loaded with neural stem cells, rapidly curing to form a three-layer cell-loaded gel layer, and culturing in vitro for 4-8 weeks to obtain a multi-layered cell-loaded nerve repair conduit. The nerve repair conduit has the functions of conducting electricity, resisting inflammation and promoting nerve differentiation, and provides a new strategy for the repair of nerve and spinal cord injuries.

The invention discloses a multi-layer integrated cell-loaded nerve repair conduit with conductive, anti-inflammatory and neural differentiation promoting functions and a preparation method thereof. The preparation method comprises the following steps: 1) preparing PLGA fibers doped with graphene, and weaving the PLGA fibers to obtain a layer of cylindrical fiber net; 2) preparing an HAMA mixed solution mixed with microspheres loaded with nerve growth promoting factors and manganese dioxide nanoparticles, and an HAMA solution loaded with neural stem cells; 3) fixing the cylindrical fiber net in a cylindrical groove mold, pouring an HAMA mixed solution, and freeze-drying after UV curing to obtain a two-layer porous composite scaffold; and (4) dipping in a neural stem cell-loaded HAMA solution, quickly curing to form three cell-loaded gel layers, and culturing in vitro for 4-8W to obtain the multi-layer integrated cell-loaded neural repair conduit. The nerve repair catheter has the functions of conducting electricity, resisting inflammation and promoting neural differentiation, and a brand new strategy is provided for nerve and spinal cord injury repair.

The invention discloses a long-chain non-coding RNA (Ribonucleic Acid) Link-NSC, shRNA (Short Hairpin Ribonucleic Acid) for interfering the expression of the Link-NSC, and application of an interference vector containing the Link-NSC in neural stem cell differentiation. The Link-NSC provided by the invention can be used for remarkably promoting the differentiation of neural stem cells, inducing cell apoptosis and reducing cell proliferation; the Link-NSC expression is knocked down under the in-vitro condition, proliferation of the neural stem cells can be promoted, differentiation and apoptosis of the neural stem cells can be inhibited, and a new means is provided for patients needing stem cell transplantation treatment.

The present disclosure provides a microfluidic device for simulating a blood-brain barrier and a blood-brain barrier simulation system including the same, and the microfluidic device includes: a first channel; a second channel which is adjacently connected to the first channel through one or more microholes and configured to culture neural stem cells; and a chamber which is connected to both ends of the first channel and contains a culture medium.

The present application relates to a cerebrospinal fluid-enriched silk fibroin hydrogel support system loaded with neural stem cell exosomes, a preparation method and applications thereof, in particular, a cerebrospinal fluid-enriched silk fibroin hydrogel loaded with neural stem cell-derived exosomes to promote the repair of neurons after spinal cord injury, belonging to the technical field of biological medicine. The present application designs engineered neural stem cell exosomes targeting neuron cells, which can improve the ischemic environment after spinal cord injury, promote vascular regeneration and inhibit neuron aging, and is more beneficial to local nerve repair and regeneration. By combining with the cerebrospinal fluid-enriched silk fibroin hydrogel to form an exosome sustained-release system applied to the local spinal cord injury, the treatment efficiency of the exosomes is improved, rapid release is realized, the cumulative release amount is large, the action time is long, the functional recovery after spinal cord injury is obviously improved, and good practical application value is achieved.

The invention discloses application of miR-652-3p in preparation of a medicine for promoting neural stem cells to differentiate into neurons, and belongs to the technical field of neural stem cell differentiation, the nucleotide sequence of the miR-652-3p is SEQ ID NO.1: AAUGGCGCCACUAGGGUUGUG, the miR-652-3p can promote the neural stem cells to differentiate into neurons in vitro, and the miR-652-3p can be used for preparing the medicine for promoting the neural stem cells to differentiate into neurons.

The application provides application of barium titanate-gold composite nanoparticles in promoting proliferation and / or differentiation of neural stem cells, and belongs to the technical field of medicines. The barium titanate-gold composite nanoparticles have a core-shell structure, and comprise a barium titanate nano core and a gold shell layer wrapped on the surface of the barium titanate nano core. The barium titanate-gold composite nanoparticles can generate weak current stimulation under near-infrared light stimulation to promote proliferation and differentiation of neural stem cells, and can especially promote differentiation of neural stem cells into mature neurons.

Disclosed herein are a microelectrode chip and a method for differentiating neural stem cells into neurons using same. The microelectrode chip can efficiently differentiate neural stem cells into neurons, thereby enabling the production of a large quantity of functional neurons through the differentiation of patient-specific neural stem cells. This facilitates quality-controlled production of neurons and can be widely used in various fields, including platforms for screening neural regeneration candidates and research into treatments for various degenerative neurological diseases.

The invention discloses a preparation method and application of an iPS (induced pluripotent stem)-containing reprogramming neuron stem cell. According to the method, the quality and the reliability of cell preparation are remarkably improved through combination of multi-step strict control and an innovative technology. All links from cell collection to reprogramming induction and then to neural differentiation and function verification are closely connected to form a complete system. Particularly, positive clones are screened through alkaline phosphatase staining in S3, and multipotential gene expression is detected in combination with real-time quantitative PCR, so that accurate judgment on iPSC multipotential is enhanced, low-quality clone interference is effectively eliminated, and a high-quality starting material is provided for subsequent gene editing and neural differentiation. The strict quality control runs through the whole process, the differentiation efficiency and the functional maturity of the neuron stem cells are improved, and it is ensured that the finally obtained cells have stable biological characteristics.