Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

23 results about "Cancer Cause" patented technology

Condensed ring compound and application in KRAS inhibitor

The invention discloses a fused ring compound, a pharmaceutical composition containing the fused ring compound and application. The compound has a structure as shown in a formula (I) or a tautomer, a meso-mer, a raceme, an enantiomer, a diastereoisomer or a mixture form, a metabolite, a metabolism precursor, an isotope substitution form, a pharmaceutically acceptable salt, a hydrate, a solvate, a polymorphic substance or an eutectic substance thereof, the compound can be used for treating one or more cancers caused by KRAS mutation.
Owner:CHENGDU HYPERWAY PHARM CO LTD +1

Condensed ring compound and application

The invention discloses a fused ring compound, a pharmaceutical composition containing the fused ring compound and application. The compound has a structure as shown in a formula (I) or a tautomer, a meso-mer, a raceme, an enantiomer, a diastereoisomer or a mixture form, a metabolite, a metabolism precursor, an isotope substitution form, a pharmaceutically acceptable salt, a hydrate, a solvate, a polymorphic substance or an eutectic substance thereof. The compound can be used for treating cancers caused by KRAS mutation, the cancers caused by KRAS mutation are selected from one or more of cancers caused by KRASG12C, KRASG12V, KRASG12A and G12D mutation, and particularly, the compound can be used as a G12D inhibitor and has relatively high inhibitory activity.
Owner:CHENGDU HYPERWAY PHARM CO LTD +1

An activity-enhanced TCR and its applications

This invention discloses an enhanced TCR and its uses. The enhanced TCR includes an α-chain variable region containing CDR1α, CDR2α, and CDR3α, and a β-chain variable region containing CDR1β, CDR2β, and CDR3β; wherein the enhanced TCR has a T30H mutation relative to the parental TCR's CDR1α, or the enhanced TCR has an S102H or G99H mutation relative to the parental TCR's CDR3α. The enhanced TCR provided by this invention is obtained by mutation based on the parental TCR, possessing a highly sensitive ability to bind target antigen peptides, significantly improving target cell recognition ability, and mediating the specific killing effect of effector cells on antigen-positive target cells, and exhibiting no allogeneic reaction to different HLA subtypes. It can be used to treat various cancers caused by KRAS G12D positivity.
Owner:ZHEJIANG UNIV +1

Preparation method of nano-enzyme preparation as well as product and application of nano-enzyme preparation

The invention discloses a preparation method of a nano-enzyme preparation as well as a product and application of the nano-enzyme preparation. The synthesis method of the nano-enzyme preparation comprises the following steps: mixing a transmembrane protein solution and a solution containing one or more nano-enzymes to prepare the nano-enzyme preparation. The nano-enzyme can target a disease site, and on one hand, the nano-enzyme removes active oxygen and active nitrogen species on the disease site; on the other hand, the nano-enzyme can be combined with cytokines of disease parts, the promotion effect of the cytokines on diseases is inhibited, and the effect of preventing and treating colitis and colitis-related colon cancer diseases is achieved. The nano-enzyme developed by the invention not only can relieve oxidative stress of diseases, but also can reduce the pro-inflammatory and tumor-promoting effects of cytokines, and can effectively treat colitis-related colon cancer caused by deterioration of colitis.
Owner:NANJING UNIV

A COX2 inhibitory peptide, a composition for inhibiting COX2, and its application.

This invention provides a COX2 inhibitory peptide, a composition for inhibiting COX2, and its application, belonging to the field of bioactive peptide technology. The amino acid sequence of the COX2 inhibitory peptide of this invention includes RGPF, FPK, or NPW. Studies have found that COX2 inhibitory peptides with amino acid sequences such as RGPF, FPK, or NPW exhibit an IC50 (increase in activity) for inhibiting COX2 activity. 50 The values ​​were 360.17±32.60 μM, 640.33±10.29 μM, and 1100.90±89.93 μM, respectively, which can effectively inhibit the activity of COX2, thereby effectively preventing and / or treating inflammation and cancer caused by COX2, and also achieving antipyretic and analgesic effects. Meanwhile, the COX2 inhibitory peptide of this invention has the advantages of being safe, non-toxic, and highly water-soluble, providing a safe option for the clinical use of COX2 inhibitors.
Owner:NORTHWEST A & F UNIV +1

Antibody against human mesothelin and use thereof

The present invention relates to an antibody that specifically binds to mesothelin and use thereof. In an aspect of the present invention, it was confirmed that an anti-MSLN antibody or antigen-binding fragment thereof comprising a CDR consisting of a specific amino acid sequence binds to MSLN, which is an antigen, with very high specificity, and the anti-MSLN antibody or an antigen-binding fragment thereof can be used not only as a therapeutic agent capable of delivering a drug through cell internalization, but also as an anti-MSLN antibody-drug conjugate capable of killing cancer cells by targeting MSLN. Therefore, the anti-MSLN antibody or an antigen-binding fragment thereof, according to an aspect of the present invention, and a composition comprising same have an excellent effect of preventing or treating cancer caused by MSLN overexpression or predicting or diagnosing the cancer.
Owner:FATIABGEN INC +1

Fused ring compound, pharmaceutical composition containing same, and use of fused ring compound

PendingAU2023254280B2MetaboliteKras mutation
The present invention relates to the technical field of medicines, and provides a fused ring compound, a pharmaceutical composition containing the same, and use of the fused ring compound. The compound has a structure as shown in formula (I), or a tautomer, a mesomer, a racemat, an enantiomer, a diastereoisomer or a mixture thereof, a metabolite, a metabolic precursor, an isotope substitution form, a pharmaceutically acceptable salt, a hydrate, a solvate, a polymorph or a eutectic substance thereof. The compound provided by the present invention can be used for treating cancers caused by KRAS mutation. The cancers caused by KRAS mutation are selected from one or more cancers caused by KRAS G12C, KRAS G12V, KRAS G12A and G12D mutations. In particular, the compound can serve as a G12D inhibitor and has relatively high inhibitory activity.
Owner:CHENGDU HYPERWAY PHARM CO LTD +1

A strain of Lactobacillus paracasei and its application

PendingCN122081149AHigh biosecurityHigh salinityAntibacterial agentsBacteriaHemolytic streptococcusProbiotic bacterium
This invention belongs to the field of probiotic screening and application technology, specifically relating to a strain of *Lactobacillus paracasei* and its application in the prevention and treatment of colonic polyps and colon cancer. The *Lactobacillus paracasei*, named *Lactobacillus paracasei* V85, was deposited on January 15, 2026, at the China Center for Type Culture Collection (CCTCC), Wuhan University, China, with accession number CCTCC NO: M2026124. The *Lactobacillus paracasei* V85 provided by this invention is sensitive to common antibiotics and has good biosafety; it possesses strong antioxidant function and a strong inhibitory effect on hemolytic streptococci; it can produce a strong agglutination effect with hemolytic streptococci, which is beneficial for inhibiting the colonization of hemolytic streptococci in the intestine, reducing the risk of colonic polyps and colon cancer caused by hemolytic streptococci, and can promote the proliferation of *Akkermansia myxophilus*. It can be used to prevent and treat colonic polyps and colon cancer caused by hemolytic streptococci, and has broad application prospects.
Owner:QINGDAO VLAND BIOTECH INC +1

Application of substance specifically binding to ICAM1 in combination with RET inhibitor in preparation of product for treating cancer caused by RET variation

The invention relates to the field of medicine, in particular to application of a substance specifically binding to ICAM1 in combination with an RET inhibitor in preparation of a product for treating cancers caused by RET variation, and the cancers caused by RET gene variation are solid tumors resistant to small-molecule inhibitors. The substance which is specifically bound with the ICAM1 is selected from an antibody coupling medicine, and the antibody coupling medicine is selected from anti-ICAM1mAb-MC-VC-PAB-MMAE or anti-ICAM1mAb-MC-GGFG-Dxd, and the substance which is specifically bound with the ICAM1 is selected from a substance which is specifically bound with the ICAM1, a substance which is specifically bound with the ICAM1 and a substance which is specifically bound with the ICAM1. According to the invention, a generally highly expressed antigen epitope ICAM1 is found in a solid tumor with RET gene variation, and the precise targeting effect and the efficient inhibition capability of ICAM1-MMAE and ICAM1-DXd on tumor cells with RET mutation are evaluated on the in-vivo and in-vitro aspects; the ICAM1-ADCs and the obtained specific RET inhibitor BLU-667 are combined for use, and the combined synergistic capability of the ICAM1-ADCs and the obtained specific RET inhibitor BLU-667 is evaluated.
Owner:ZHEJIANG UNIV OF TECH +1

A rapid dehydration and transparency method for pathological sections

ActiveCN116358950BXylyleneTissue sample
The application provides a rapid dehydration and transparency method of pathological sections, and belongs to the technical field of tissue sample preparation. The rapid dehydration and transparency method comprises the following steps: dehydrating an in-vitro tissue by using ethanol solutions with volume concentrations from low to high, and then transparently treating the dehydrated in-vitro tissue in a fatty alcohol polyoxyethylene ether, wherein the temperature of the dehydration treatment and the transparency treatment is 55-65 DEG C. The application sets the temperature of the dehydration treatment and the transparency treatment as 55-65 DEG C, which significantly shortens the time of the dehydration treatment and the transparency treatment. The application replaces xylene, which is used in the traditional preparation of pathological sections, with a fatty alcohol polyoxyethylene ether, which not only avoids the risk of cancer caused by long-term contact with xylene, but also achieves the same transparency effect as xylene. Experimental results show that, compared with the traditional method, the pathological sections prepared by the application not only significantly shorten the time of dehydration and transparency treatment, but also do not affect the section quality due to the shortened time.
Owner:BEIJING ENRUIKANG AGRI TECH CONSULTING CO LTD

A new preparation method of flavonoids and its application

The present invention provides a new flavonoid compound and its preparation method and application, belonging to the field of medical technology. The flavonoid compound is isolated from the Calophyllum membranaceum Gardn.et Champ. of the Guttiferae family. The dried stems and leaves of Calophyllum membranaceum are taken, and a new flavonoid compound is obtained by extract extraction, MCI segmentation decolorization, silica gel column chromatography, open ODS column chromatography, Sephadex LH-20 gel column chromatography, and semi-preparative HPLC chromatography: the preparation method of the present invention is simple to operate and has a high degree of purification. The flavonoid compound of the present invention can target and inhibit CYP1A1 enzyme activity, can be used as a lead compound for developing drugs that inhibit CYP1A1 enzyme activity, is expected to prevent or treat cancers caused by pro-carcinogens / mutagens such as polycyclic aromatic hydrocarbons and heterocyclic aromatic amines, and has potential clinical application value in the development of drugs such as anti-lung cancer, anti-breast cancer, and anti-colon cancer.
Owner:KUNMING MEDICAL UNIVERSITY

An OMV vaccine capable of preventing Helicobacter pylori infection and preparation method thereof

The present invention relates to an OMV vaccine that can prevent Helicobacter pylori infection and a preparation method thereof. The vaccine uses a conserved trisaccharide (Trio) in Helicobacter pylori lipopolysaccharide as a core antigen epitope, and its structure is α-DD-Hep-(1→3)-α-D-Fuc-(1→3)-β-D-GlcNAc-. The epitope is biosynthesized by recombinant Escherichia coli, and a non-reducing end of a core oligosaccharide on the Escherichia coli outer membrane vesicle (OMV) is used as a connection anchor. The oligosaccharide is catalyzed and synthesized by glycosyltransferases from Helicobacter pylori and Escherichia coli. Trio can be efficiently displayed on the surface of OMV using this oligosaccharide on the surface of bacteria. Animal experiments have shown that the vaccine has the ability to activate the body's immune response and protective efficacy, and can be developed as a vaccine to prevent Helicobacter pylori infection. It has important application value and significance for effectively preventing and treating diseases such as peptic ulcers, chronic inflammation, and even gastric cancer caused by Helicobacter pylori infection.
Owner:BEIJING ZHIFEI LVZHU BIOPHARMACEUTICAL CO LTD +2

Protein recognizing k-ras gene mutation cancer

The object of the present disclosure is to provide a protein that selectively recognizes cancer caused by a mutation of K-Ras gene (herein particularly referred to as "K-Ras gene mutation cancer"). Provided are a production method of a protein that selectively recognizes K-ras gene mutation cancer characterized in that it comprises first to third steps of linking first to third specific sugar chains respectively to lysine residues on the protein molecule, as well as the protein produced by the aforementioned method. Moreover, a pharmaceutical composition for cancer therapy comprising said protein is provided.
Owner:RIKEN CO LTD +1

Pyrimidine derivative and pharmaceutical composition comprising same

The present invention provides: a novel pyrimidine derivative compound that inhibits the growth of cancer cells; and a pharmaceutical composition for preventing and treating cancers including lung cancer, the composition containing a pharmaceutically acceptable salt of the compound as an active ingredient. In particular, the novel compound according to the present invention has an excellent inhibitory effect on exon 20 insertion EGFR mutants and excellent selectivity to wild-type EGFR, and is useful as an agent for preventing, alleviating and treating cancers caused by these EGFR mutant species.
Owner:THERAPEX CO LTD

Plant lactobacillus and its application in preventing and treating colon polyp or colon cancer

PendingCN122326453AEnhanced inhibitory effectStrong agglutination effectProbiotic bacteriumCytokine
This invention belongs to the field of functional probiotic screening and application technology, specifically involving a novel strain of *Lactobacillus plantarum* (…). Lactiplantibacillus plantarum The *Lactobacillus plantarum* strain was deposited on January 15, 2026, at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China, with accession number CCTCC NO: M202026133. This strain exhibits strong antioxidant capacity, significant inhibitory and flocculating effects against hemolytic streptococci, and can significantly reduce the levels of pro-inflammatory cytokines IL-6 and IL-1β induced by hemolytic streptococci while increasing the level of the anti-inflammatory cytokine IL-22. It has no toxic effects on the body, good safety profile, and can be used to prevent colonic polyps and colon cancer caused by hemolytic streptococci, showing broad application prospects.
Owner:QINGDAO VLAND BIOTECH INC +1

External traditional Chinese medicine gel for preventing or treating HPV (human papillomavirus) infection as well as preparation method and application of external traditional Chinese medicine gel

The invention relates to traditional Chinese medicine external gel for preventing or treating HPV (human papillomavirus) infection as well as a preparation method and application of the traditional Chinese medicine external gel. The traditional Chinese medicine external gel comprises an active composition and a gel matrix, the active composition comprises a traditional Chinese medicine extract and menthol, and the traditional Chinese medicine extract comprises the following raw materials in parts by weight: 9-15 parts of radix sophorae flavescentis, 9-15 parts of cortex phellodendri, 12-20 parts of rhizoma smilacis glabrae, 9-12 parts of honeysuckle, 9-12 parts of fructus forsythiae, 6-12 parts of safflower, 12-20 parts of fructus cnidii, 6-12 parts of rhizoma bletillae, 6-12 parts of radix aucklandiae and 12-20 parts of cockscomb; 5 to 10 parts by weight of menthol; the weight part of the gel matrix is 260 to 800 parts. The traditional Chinese medicine external gel provided by the invention can effectively inhibit HPV virus replication, treat cervical precancerous lesions caused by HPV infection and prevent cancers caused by HPV infection, and the traditional Chinese medicine external gel is convenient to use, stable in action effect and high in safety, and has important clinical significance.
Owner:SHANGHAI IMPSEN BIOTECHNOLOGY CO LTD

Application of STT3A gene inhibitor in treatment of RSPO and / or RNF43 / ZNRF3 gene mutant cancer

The invention provides an application of an STT3A gene inhibitor in treatment of RSPO and / or RNF43 / ZNRF3 gene mutation type cancers. The STT3A gene inhibitor can be used for treating the RSPO and / or RNF43 / ZNRF3 gene mutation type cancers. Specifically, the STT3A gene inhibitor can inhibit N-glycosylation modification of LRP6, so that abnormal activation of a Wnt pathway caused by RSPO and / or RNF43 / ZNRF3 gene mutation is inhibited, and cancers caused by abnormal activation of the Wnt pathway are treated. In addition, the invention also provides a pharmaceutical composition and a treatment method for treating RSPO and / or RNF43 / ZNRF3 gene mutant cancers.
Owner:CENT FOR EXCELLENCE IN MOLECULAR CELL SCI CHINESE ACAD OF SCI

Pyrazolo[1,5-a]pyrimidine derivatives, their preparation methods and uses

This invention relates to the pyrazolo[1,5-a]pyrimidine derivative of Formula I, its preparation method, and its uses. It can be used as a PI3Kα inhibitor to treat cancers caused by dysregulation of the PI3Kα signaling pathway, such as breast cancer, lung cancer, or rectal cancer. Furthermore, the preparation method of this compound is simple and it has certain application prospects.
Owner:杭州贝奥科瑞生物科技有限公司

Lactobacillus rhamnosus and application thereof in prevention and treatment of colon polyps and colon cancer

PendingCN122104514AAntibacterial agentsBacteriaGastric digestionLactobacillus rhamnosus
This invention belongs to the field of probiotic screening and application technology, specifically relating to a strain of *Lactobacillus rhamnosus* and its application in the prevention and treatment of colon polyps and colon cancer. The *Lactobacillus rhamnosus* is named *Lactobacillus rhamnosus* (…). Lacticaseibacillus rhamnosus S28, deposited on January 15, 2026, at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China, with accession number CCTCC NO: M2026129, exhibits strong inhibitory activity against *Streptococcus bovis* and demonstrates a strong agglutination effect with it. It can be used to prevent or treat colonic polyps and colon cancer caused by *Streptococcus bovis*. This invention also provides probiotic pellets containing *Lactobacillus rhamnosus* S28, which exhibit strong resistance, effectively protecting the probiotics from gastric digestion, ensuring their smooth arrival in the intestines, and achieving rapid disintegration within the intestines, showing broad market prospects.
Owner:QINGDAO VLAND BIOTECH INC +1

Fused ring compounds, pharmaceutical compositions comprising the same and uses thereof

The present application relates to the technical field of medicine, and provides a fused ring compound, a pharmaceutical composition containing the same and application, wherein the compound has a structure shown in formula (I) or a tautomer, an entgegen isomer, an enantiomer, a diastereomer or a mixture thereof, a metabolite, a metabolic precursor, an isotopic substitution form, a pharmaceutically acceptable salt, a hydrate, a solvate, a polymorph or a co-crystal thereof; the compound provided by the present application can be used for treating cancer caused by KRAS mutation, wherein the cancer caused by KRAS mutation is one or more selected from cancer caused by KRAS G12C, KRAS G12V, KRAS G12A and G12D mutation, and in particular, the compound can be used as a G12D inhibitor and has high inhibitory activity.
Owner:CHENGDU HYPERWAY PHARM CO LTD +1

Isoindolinone derivative having arylcycloalkylamide structure, and use thereof

PendingUS20260174859A1Organic active ingredientsLeprosyThalidomide Analog
The present invention relates to an isoindolinone derivative compound having a glutarimide mother nucleus, and an application thereof, and more specifically, to an isoindolinone derivative compound in which a glutarimide mother nucleus is substituted with phenylcyclopropane having a thalidomide analog structure. The compound of chemical formula 1 according to the present invention specifically binds to the CRBN protein and is involved in functions thereof. Thus, the compound of the present invention may be beneficially used in the prevention or treatment of leprosy, chronic graft versus host disease, inflammatory diseases, or cancer caused by actions of the CRBN protein.
Owner:ONCORD BIO INC +1

Double-target compound as well as preparation method and application thereof in preparation of VEGFR inhibitor and CA inhibitor

PendingCN120574212AOrganic active ingredientsSenses disorderProtein-Tyrosine KinasesVascular proliferation
The invention belongs to the technical field of medicinal chemistry, and particularly relates to a double-target compound, a preparation method thereof and application of the double-target compound in preparation of a VEGFR inhibitor and a CA inhibitor. The invention provides a double-target compound which has a structure as shown in a formula I, II, III or IV. The double-target compound provided by the invention has the effects of a VEGFR inhibitor and a CA inhibitor at the same time, and can be used as the VEGFR inhibitor for treating proliferative diseases or symptoms mediated by protein tyrosine kinase; the compound can be used for treating ocular diseases such as ocular pathological neovascular hyperplasia, retinal edema or ischemia and diseases such as malignant tumors and cancers caused by abnormal vascular hyperplasia, and can be used as a CA inhibitor for intraocular pressure rise related diseases and symptoms. The traditional Chinese medicine composition can be used for treating eye diseases such as glaucoma, glaucoma-ciliary cyclitis syndrome, dilation-period cataract and the like, diabetes mellitus, cardiovascular diseases and the like.
Owner:SHENYANG PHARMA UNIV

DNA aptamer for inhibiting FGFR1

: The present invention provides a DNA aptamer having a length of up to 80 nucleotides, preferably up to 40 nucleotides, and being or containing the sequence: GGGATACAGGGCTXTGTCTATGGTGTGGATGGCGGATACC (SEQ ID NO. 1), wherein X is T or A, and wherein one to three deoxynucleotides may optionally be modified by fluorination, and / or wherein one or more of deoxyguanosines G10, G22 and G31 may optionally be modified by replacing H2´ of the sugar moiety with F, O-methyl, O-methoxyethyl, or by forming a covalent methylene or ethylene bridge between 2'-O and 4'-C, and / or wherein one or more of G10, G22 and G31 may optionally be modified by replacing the hydrogen atom at the C8 carbon atom of the guanine base with bromine atom or with methyl, and / or wherein the phosphodiester linkage may optionally be replaced by phosphorothioate linkage in one or more nucleotides. The DNA aptamers according to the invention are selective FGFR1 inhibitors and are useful in the treatment of skeletal disorders, developmental disorders, and cancers caused by aberrant FGFR1 signaling.
Owner:MASARYK UNIVERSITY