47 results about "Mutant cell" patented technology

The invention discloses a method for detecting a diallele editing cell based on a CRISPR / Cas12a technology. The invention provides crRNA, and the nucleotide sequence of a binding target of the crRNA is SEQ ID NO.6. The crRNA is obtained by in-vitro transcription of a transcription template; the transcription template is a product obtained by annealing a single-stranded DNA (Deoxyribose Nucleic Acid) molecule as shown in SEQ ID NO.10 and a single-stranded DNA molecule as shown in SEQ ID NO.13. The invention provides crRNA of the CD71 gene, a CRISPR / Cas12a system is constructed by using the crRNA, CRISPR / Cas12a detection is performed, screening of CRISPR / Cas9 induced CD71 gene diallele editing cells is realized, and the method is simple, convenient, quick and convenient for economically and effectively screening a large number of mutant cells.

This disclosure relates to cell therapy approaches for treating progranulin (PGRN) deficiencies with human induced pluripotent stem cell (hiPSC)-derived cells. Advantageously, the hiPSC-derived cells (e.g., microglia progenitor cells) described herein can cross-correct PGRN deficiencies in damaged or diseased cells while reducing the amount of endogenous cell ablation that is needed, as demonstrated by experimental results showing restoration of PGRN levels in GRN mutant cells and brain organoids.

The present disclosure provides methods and systems for targeting cell with mutations.

The invention provides a construction method of a non-small cell lung cancer histone H1.3 arginine methylation point mutation cell model. The construction method comprises the following steps: designing mutation primers H1.3 R80A-F and H1.3 R80A-R; the method comprises the following steps: by taking a pCDH-HA-H1.3-Flag plasmid as a template, carrying out PCR (Polymerase Chain Reaction) amplification by adopting a mutation primer, digesting a product by DMT enzyme, and converting a competent cell to obtain a mutant plasmid; and co-transfecting the mutant plasmid and a helper plasmid to a packaging cell, collecting a virus solution, filtering, infecting an A549 cell, adding Polybrene to assist infection, culturing, and screening a stably transfected cell strain by using puromycin to obtain the recombinant plasmid. The invention also provides application of the mutant cell model obtained by the construction method. According to the invention, the blank of histone H1.3 methylation research is filled, the 80th arginine is clear as a core modification site, and the established model provides a new tool for lung cancer mechanism research and drug research and development.

The present invention relates to processes for the oxidation of sesquiterpenes comprising fused 5- and 7-membered rings using mutant Cytochrome P450 family 102A sub-family member (CYP102A) enzymes. The invention also relates to mutant CYP102A enzymes, polynucleotides encoding the enzymes, cells expressing the enzymes, transgenic animals or plants comprising the enzymes, and compounds produced by the processes.

The application discloses a method for detecting double allelic gene edited cells based on CRISPR / Cas12a technology. The application provides crRNA, wherein the nucleotide sequence of a target point is SEQ ID NO. 6. The crRNA is obtained by in vitro transcription of a transcription template; the transcription template is a product obtained by annealing of a single-stranded DNA molecule shown in SEQ ID NO. 10 and a single-stranded DNA molecule shown in SEQ ID NO. 13. The application provides crRNA of a CD71 gene, and a CRISPR / Cas12a system is constructed by using the crRNA, CRISPR / Cas12a detection is carried out, double allelic gene edited cells of the CD71 gene induced by CRISPR / Cas9 are screened, and the method is simple, easy, fast, and convenient for economically and effectively screening a large number of mutant cells.

The invention discloses application of an LPIN1 inhibitor in preparation of drugs for treating FLT3-ITD mutant acute myelogenous leukemia, reducing tumor load of a patient with the FLT3-ITD mutant acute myelogenous leukemia, improving the survival rate of the patient with the FLT3-ITD mutant acute myelogenous leukemia and / or reducing the proliferation activity of primary cells of the patient with the FLT3-ITD mutant acute myelogenous leukemia. The LPIN1 inhibitor for inhibiting lipid metabolism related enzyme LPIN1 can significantly induce apoptosis of FLT3-ITD mutant AML cells, has limited influence on non-mutant AML cells, and has mutation specificity. More importantly, the LPIN1 inhibitor (such as propranolol) and the FLT3 inhibitor (such as quinatinib) are combined for use, so that a synergistic anti-leukemia effect can be generated, and a remarkable anti-tumor effect is shown in vitro and in a mouse transplantation tumor model, so that the LPIN1 inhibitor and the FLT3 inhibitor have a good application prospect.

The invention relates to the technical field of tomato culture, and discloses a high-yield and high-quality tomato tissue culture method, which comprises the following steps: disinfecting a stem section on a tomato plant as a tomato explant, and inserting the stem section into a preset induction culture medium for induction culture so as to generate a callus; transferring into a preset proliferation culture medium, and performing adventitious bud differentiation induction; transferring the induced explant into a preset differential culture medium, and carrying out adversity differentiation induction; transferring the explant subjected to adversity differentiation induction into a rooting culture medium for rooting culture to obtain a complete regenerated plant; the regenerated plants are subjected to seedling hardening treatment, and the regenerated plants subjected to seedling hardening are transplanted. Plant hormones with different concentrations and PEG-8000 are added into a culture medium to cause osmotic stress, permeation-resistant mutant cells in tomato calluses are screened, callus cell regeneration is induced, and mutants are screened out through leaf phenotypes and growth vigor of regenerated plants and serve as resistant germplasm resources for tomato breeding.

Compositions and method of prevention and treatment for a subject in need comprising drug-resistant natural killer (NK) cells, which are effective for treating cancer when administered in conjunction with cytotoxic therapies. A method of treatment comprising administering to a subject in need thereof an effective amount of modified NK cells and a cytotoxic therapy. A purified cell composition comprising modified NK cells. A pharmaceutical composition comprising an effective amount of G101V mutated NK cells and venetoclax.

The invention relates to a mutant cell strain of ZNF717 L39V, which is characterized in that CTG is mutated into GTG, leucyl (L) at the 39th site is mutated into valine (V), and the mutation sequence of the valine (V) is GGTGTCCTTGAGGAGGTAGCTGCACCTCGGGAGGAGTGGCAGGATGATGCTCAG. The mutant cell strain of ZNF717 L39V is characterized in that CTG is mutated into GTG, leucyl (L) at the 39th site is mutated into valine (V), and the mutation sequence of the valine (V) is shown in the specification. According to the gRNA sequence of the ZNF717 L39V and the ssDNA donor sequence of the ZNF717 L39V, which are designed by the invention, a mutation sequence can be obtained, the mutation efficiency is high, and a mutation site and a base sequence after mutation can be accurately controlled.

The invention relates to the technical field of cell engineering, in particular to a cell strain causing pathogenic splicing mutation of a female HA patient and a construction method of the cell strain. A construction method of the T point mutation cell strain comprises the following steps: designing an sgRNA sequence based on a mutation site of a target gene F8; the method comprises the following steps: based on an sgRNA sequence and a CRISPR / Cas9 gene editing technology, constructing a plurality of pX458-sgRNA plasmids by taking a pX458 plasmid as a vector; the method comprises the following steps: constructing an LA-pMD-18T-pGK-puro-mcherry-RA donor plasmid by taking a pMD-18T-pGK-puro-mcherry plasmid as a vector on the basis of an sgRNA (small guide ribonucleic acid) sequence and a pX458-sgRNA plasmid; the preparation method comprises the following steps: simultaneously transfecting a pX458-sgRNA plasmid and an LA-pMD-18T-pGK-puro-mcherry-RA donor plasmid into a cell, and carrying out drug screening, so as to obtain a stable cell strain. In addition, the invention also provides application of the mutant cell strain. The discovery of the novel pathogenic splicing mutation not only enriches an F8 gene mutation database, but also provides a new strategy for precise treatment of female HA patients in the future.

The invention discloses a generic KRAS mutation inhibitor and application thereof, and belongs to the technical field of biomedicine. The inhibitor disclosed by the invention is a triaromatic ring compound, can selectively inhibit the proliferation of KRAS mutant cells by blocking the function of REG gamma-20S proteasome, and is used for treating KRAS mutant tumors or cancers. The method has a wide application prospect.

The invention involves the provision of recombinant algal mutants that have a genetic modification to a nucleic acid sequence encoding a trehalose biosynthetic enzyme, and / or a genetic modification to a nucleic acid encoding an RNA binding domain And in some embodiments either of these algal mutants can further have a genetic mutation to a nucleic acid sequence encoding an SGI1 polypeptide. Attenuation of one, two, or all three of these genes results in a mutant organism with increased lipid productivity. It was also discovered that one, two, three, or more genetic mutations can be accumulated or “stacked” in a particular mutant cell or organism to result in further increases in the production of lipid products. The lipid products of these mutants are useful as biofuels or for other specialty chemical products.

The invention belongs to the technical field of biology, and provides a cell model and an animal model for neurodevelopmental diseases caused by GOF (Gain of Function) mutation of GABAAR, and a construction method and application of the cell model and the animal model. The neurodevelopmental disease cell model and the animal model comprise GABRB3 gene point mutation cells, and the point mutation is that leucine at the 235th site is mutated into alanine. The neurodevelopmental disease cell model constructed by the invention has high disease relevance and stable expression, and can be used as a humanized cell model for in-vitro drug screening.

The invention relates to the technical field of gene engineering, in particular to a construction method and application of a JAK2V617F mutant cell model based on CRISPR / Cas9, and the construction method specifically comprises the following steps: designing an sgRNA sequence based on a JAK2V617F mutation site; the method comprises the following steps: constructing a pX458-JAK2-sgRNA plasmid by taking a pX458 plasmid as a vector; an ssODN-Donor sequence is designed; a pX458-JAK2-sgRNA plasmid and an ssODN-Dornor sequence are respectively prepared into transfection complexes, the transfection complexes are transfected into THP1 cells, and after culture, extraction and identification, a JAK2V617F mutant cell model is successfully constructed. The invention not only solves the problem that in-vitro models of neutrophils and monocytes carrying JAK2V617F mutation cannot be constructed in the prior art, but also deeply reveals the mechanism of abnormal high expression of inflammatory factors of MPN patients, and promotes the screening and development of novel anti-inflammatory and anti-fibrosis drugs.

The invention provides application of mitochondrial vesicles in reduction of mitochondrial DNA deletion mutation. The mitochondrial vesicles are prepared by wrapping mitochondria with erythrocyte membranes, the mitochondrial vesicles can be tested and verified to effectively reduce the mitochondrial DNA deletion mutation level in cells, metabolism and functions of mutant cells are improved, verification is further carried out in muscle cells of CPEO patients, and the clinical application prospect is wide. By implanting the mitochondrial vesicles, the mitochondrial DNA deletion mutation level in the CPEO patient muscle cells can be effectively reduced, which indicates that the mitochondrial vesicles have the potential of treating CPEO, and a new thought is provided for treating diseases related to mitochondrial DNA deletion mutation.

A method for detecting bi-allelic gene edited cells based on CRISPR / Cas12a technology is provided. The method provides crRNA, a nucleotide sequence of which that binds target is SEQ ID NO: 6. The crRNA is transcribed from a transcription template in vitro; the transcription template is a product obtained by annealing a single stranded DNA molecule shown in SEQ ID NO: 10 and a single stranded DNA molecule shown in SEQ ID NO: 13. The method provides crRNA of CD71 gene and constructs a CRISPR / Cas12a system using the same for CRISPR / Cas12a detection, achieving the screening for CRISPR / Cas9 induced CD71 gene bi-allelic gene edited cells. This method is simple, easy, fast, and cost-effective for screening a large number of mutant cells.

The application discloses a selective inhibitor for BRCA mutation and application thereof. Specifically, the application relates to a quinazolinone compound shown in a general formula (I) or a pharmaceutically acceptable salt or a solvate thereof, wherein the compound has better selectivity for BRCA mutation, has a good inhibition rate on the proliferation of BRCA mutant cells at a low concentration, and is superior to existing olaparib and AZD5305 and the like. Through a nude mouse tumorigenesis experiment, it is proved that the drug obviously shows an inhibitory effect on tumor growth at a low drug concentration, and has no obvious toxic side effects.

The invention discloses a construction method and application of a mouse colorectal cancer model. The construction method specifically comprises the following steps of: constructing GT11ML; the method comprises the following steps: enabling an animal of Hprt-Cre to mate with a TG11ML animal and a P53flox animal, and finally stably obtaining the TG11ML animal and the P53flox animal; a GT11ML; and Hprt-Cre animals. The animal model constructed by the method is stable in character, and the success rate reaches 100%; compared with a traditional animal model, the method has the advantages that the whole process of occurrence and development of diseases can be simulated more truly, the transfer or abnormal behaviors of mutant cells can be monitored and the like, and the method is of great significance to development of nutrients and medicines in related fields.

This invention discloses the application of lncRNA SVIL-AS1 as a target in AKT1E17K mutant tumors, belonging to the field of molecular biology technology. This invention provides the application of lncRNA SVIL-AS1-related biomaterials in the preparation of products for regulating the function of AKT1E17K mutant cells. This invention verifies that SVIL-AS1 can specifically bind to AKT1E17K mutants and inhibit their phosphorylation level and kinase function, thereby inhibiting the proliferation of AKT1E17K mutant cells, revealing the role of SVIL-AS1 in the treatment of AKT1E17K mutant tumors. This invention applies lncRNA SVIL-AS1 to the treatment of AKT1E17K mutant tumors, not only providing a new source for the preparation of materials for the prevention and treatment of AKT1E17K mutant tumors, but also exploring new pharmaceutical value of lncRNA SVIL-AS1.

The invention discloses an application of ZmZFP1 protein and a coding gene thereof in regulation and control of plant root development, and provides an application of the ZmZFP1 protein or related biological materials thereof in regulation and control of plant root development, and the related biological materials are nucleic acid molecules capable of expressing the ZmZFP1 protein or expression cassettes, recombinant vectors, recombinant bacteria or mutant cell lines containing the nucleic acid molecules. The ZmZFP1 protein is a protein as shown in SEQ ID No.2 or a protein which has one or more nucleotide or amino acid differences with the protein as shown in SEQ ID No.2 and has the same function as the protein as the protein as shown in SEQ ID No.2. By knocking out ZmZFP1 or inhibiting ZmZFP1 expression of a corn mutant, the growth of a main root under low nitrogen stress treatment is obviously inhibited, which indicates that the gene responds to low nitrogen stress by regulating the growth of the main root, and the application provides a new germplasm resource for cultivating a new low nitrogen resistant corn variety, and has a wide application prospect. And a theoretical basis is laid for researching a mechanism of plant response to stress signals and a molecular mechanism of plant tolerance to adverse environments.

This invention discloses a method for heavy ion beam mutagenesis breeding of poultry. To address the challenges of efficient, rapid, and safe breeding in poultry, this method utilizes heavy ion beam irradiation of poultry progenitor cells (PGCs) to induce radiation mutagenesis, constructing a mutant cell library. The PGCs in this library are then isolated into single cells to form monoclonal populations. Targeted deep sequencing is used to screen for positive PGCs with gene mutations from the S2-after monoclonal population, and the mutated gene is preliminarily identified. Positive PGCs are injected via microinjection into recipient embryos after their own PGCs have been ablated, resulting in chimeras. Individuals developed from these chimeras undergo molecular screening and identification. M1 generation individuals containing the identified mutated gene are then used for breeding to obtain offspring strains that stably inherit the mutated gene. This method is efficient, rapid, safe, and avoids the ethical and regulatory risks associated with gene editing technologies, making it of significant application value for mutagenesis breeding in poultry.

A method of transposon insertion sequencing (TIS) capable of resolving insertion sites in or around repeat elements, said method including the steps of; preparing a pool or library of mutant cells by

The invention discloses an aminothiazole compound and an application thereof as an androgen receptor antagonist. The aminothiazole compound comprises pharmaceutically acceptable salts, solvates, prodrugs and isomers of the aminothiazole compound, and pharmaceutical compositions containing the aminothiazole compound and the pharmaceutically acceptable salts, the solvates, the prodrugs and the isomers of the aminothiazole compound. The aminothiazole compound has obvious antagonistic activity to AR, shows better biological activity in in-vivo and in-vitro biological evaluation, and is effective to an enzalutamide drug-resistant ARF876L / T877A two-point mutation model and a comparison caralutamide drug-resistant ARW741C mutant cell model. The percutaneous administration also shows the effect of promoting hair growth on a mouse alopecia model. Therefore, the compound can be used as an AR antagonist to prepare drugs for treating diseases related to androgen receptors, such as prostate cancer, metastatic prostate cancer, castration-resistant prostate cancer, breast cancer, ovarian cancer, androgen-derived alopecia and acne.

The invention belongs to the technical field of bioengineering, and particularly relates to an immobilized cell, a preparation method thereof and a preparation method of 2-O-alpha-D-glucopyranosyl-L-ascorbic acid. According to the method, sucrose phosphorylase mutant cells from Bifidobacterium pseudolongum are immobilized, so that the stability, the acid resistance and the reusability of the sucrose phosphorylase mutant cells are remarkably improved, sucrose and vitamin C are used as raw materials to produce 2-O-alpha-D-glucopyranosyl-L-ascorbic acid, and the activity is kept 90% or above after the sucrose phosphorylase mutant cells are continuously used for 10 batches. And the method has an important application value in the field of production of the 2-O-alpha-D-glucopyranosyl-L-ascorbic acid.

The present invention relates to Aspergillus mutants with reduced or eliminated expression and / or activity of an endogenous psi-producing oxygenase C (PpoC) comprising in its genome one or more polynucleotide encoding a polypeptide of interest heterologous to the mutant cell, methods of producing a polypeptide of interest using said host cells, as well as the use of said cells in production methods to provide fermentation products comprising reduced volatile agents.

This invention relates to a Chlorella mutant strain that is easily separated by sedimentation and cell wall disruption, and its uses, in the fields of biology and bioengineering. The Chlorella is... Chlorella pyrenoidosa GA, deposited on March 23, 2026 at the China Center for Type Culture Collection (CCTCC), accession number CCTCC NO: M2026500. This Chlorella mutant strain showed no difference in growth compared to the wild type under all culture conditions, but exhibited a significantly increased protein accumulation. Furthermore, the mutant cells settled more easily, with significantly higher natural sedimentation and centrifugation efficiencies under the same treatment conditions compared to the wild-type strain. Cell disruption was also significantly easier, facilitating digestion and absorption by predators. The mutant strain described in this invention has broad application prospects in the production of Chlorella-related products and aquaculture.

The invention discloses a construction method of an RNP-mediated ICAM-1 gene knockout HEK293 cell strain, and belongs to the technical field of gene engineering. The method comprises the following steps: S1, cell transfection: culturing HEK293 cells to prepare transfection, adding a transfection compound into the HEK293 cells for transfection, and continuing to culture; s2, cell genome extraction: performing genome extraction on the transfected HEK293 cells; s3, PCR identification: designing a primer according to a gene sequence of ICAM-1, and carrying out PCR reaction on the genome extracted in S2 by using the primer; and S4, gene level verification: sequencing a PCR product, comparing a sequencing result with a wild type sequence, and determining to obtain a mutant cell strain. The transfection compound is composed of an RNP (Ribonucleic Acid) compound and a CRISPRMAX (Clustered Regularly Interspaced Short Palindromic Repeats) reagent system, and the RNP compound contains sgRNA (Ribonucleic Acid). The monoclonal clone11 is successfully obtained finally, which indicates that RNP can mediate ICAM-1 gene knockout of the HEK293 cell strain, the knockout method is enriched, the off-target risk is reduced, and the editing efficiency is improved.

The invention discloses an HDAC8 gene knockout MDBK cell line as well as a construction method and application thereof. According to the method, a CRISPR / Cas9 technology is utilized, specific gRNA is designed aiming at a second exon of a cattle HDAC8 gene, CRISPR expression plasmids are constructed, adherent MDBK cells are transfected, and HDAC8 homozygous frame-shift mutant cell lines KOHDAC8-1 (4bp deletion) and KOHDAC8-2 (1bp insertion) are obtained through puromycin screening and monoclonal separation. An identification result shows that HDAC8 knockout obviously promotes replication of the bovine viral diarrhea virus (BVDV), the expression level of NS3 mRNA and protein of the virus is increased, the virus titer is obviously improved, and the cell growth rate is not obviously influenced. The cell line provided by the invention can be used as an efficient proliferation matrix of the BVDV, is used for producing inactivated vaccines for bovine viral diarrhea, and effectively improves the yield and quality of the vaccines.

Provided herein are therapeutic nucleic acid molecules for managing, preventing and / or treating neoplastic diseases or disorders caused by or associated with oncogenic mutations in KRAS gene. Also provided herein are therapeutic compositions, including vaccines and lipid nanoparticles, comprising the therapeutic nucleic acids and related therapeutic methods and uses.