Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

33 results about "Mutant cell" patented technology

A mutant cell line is produced in which a motor protein specific for astral microtubules is inactivated.

METHODS AND COMPOSITIONS FOR TREATING PROGRANULIN DEFICIENCIES USING iPSC-DERIVED CELLS

This disclosure relates to cell therapy approaches for treating progranulin (PGRN) deficiencies with human induced pluripotent stem cell (hiPSC)-derived cells. Advantageously, the hiPSC-derived cells (e.g., microglia progenitor cells) described herein can cross-correct PGRN deficiencies in damaged or diseased cells while reducing the amount of endogenous cell ablation that is needed, as demonstrated by experimental results showing restoration of PGRN levels in GRN mutant cells and brain organoids.
Owner:BLUEROCK THERAPEUTICS LP

Non-small cell lung cancer histone H1.3 arginine methylation point mutation cell model as well as construction method and application thereof

PendingCN121801973Agenetic stabilitySolve missing technical bottlenecksCompound screeningApoptosis detectionHistone methylationEnzyme digestion
The invention provides a construction method of a non-small cell lung cancer histone H1.3 arginine methylation point mutation cell model. The construction method comprises the following steps: designing mutation primers H1.3 R80A-F and H1.3 R80A-R; the method comprises the following steps: by taking a pCDH-HA-H1.3-Flag plasmid as a template, carrying out PCR (Polymerase Chain Reaction) amplification by adopting a mutation primer, digesting a product by DMT enzyme, and converting a competent cell to obtain a mutant plasmid; and co-transfecting the mutant plasmid and a helper plasmid to a packaging cell, collecting a virus solution, filtering, infecting an A549 cell, adding Polybrene to assist infection, culturing, and screening a stably transfected cell strain by using puromycin to obtain the recombinant plasmid. The invention also provides application of the mutant cell model obtained by the construction method. According to the invention, the blank of histone H1.3 methylation research is filled, the 80th arginine is clear as a core modification site, and the established model provides a new tool for lung cancer mechanism research and drug research and development.
Owner:ANHUI UNIV

A method for detecting double allele edited cells based on CRISPR / Cas12a technology

The application discloses a method for detecting double allelic gene edited cells based on CRISPR / Cas12a technology. The application provides crRNA, wherein the nucleotide sequence of a target point is SEQ ID NO. 6. The crRNA is obtained by in vitro transcription of a transcription template; the transcription template is a product obtained by annealing of a single-stranded DNA molecule shown in SEQ ID NO. 10 and a single-stranded DNA molecule shown in SEQ ID NO. 13. The application provides crRNA of a CD71 gene, and a CRISPR / Cas12a system is constructed by using the crRNA, CRISPR / Cas12a detection is carried out, double allelic gene edited cells of the CD71 gene induced by CRISPR / Cas9 are screened, and the method is simple, easy, fast, and convenient for economically and effectively screening a large number of mutant cells.
Owner:AGSINO GENSOURCES CO LTD

Application of LPIN1 inhibitor in preparation of medicine for treating FLT3-ITD mutant acute myelogenous leukemia

The invention discloses application of an LPIN1 inhibitor in preparation of drugs for treating FLT3-ITD mutant acute myelogenous leukemia, reducing tumor load of a patient with the FLT3-ITD mutant acute myelogenous leukemia, improving the survival rate of the patient with the FLT3-ITD mutant acute myelogenous leukemia and / or reducing the proliferation activity of primary cells of the patient with the FLT3-ITD mutant acute myelogenous leukemia. The LPIN1 inhibitor for inhibiting lipid metabolism related enzyme LPIN1 can significantly induce apoptosis of FLT3-ITD mutant AML cells, has limited influence on non-mutant AML cells, and has mutation specificity. More importantly, the LPIN1 inhibitor (such as propranolol) and the FLT3 inhibitor (such as quinatinib) are combined for use, so that a synergistic anti-leukemia effect can be generated, and a remarkable anti-tumor effect is shown in vitro and in a mouse transplantation tumor model, so that the LPIN1 inhibitor and the FLT3 inhibitor have a good application prospect.
Owner:THE FIFTH MEDICAL CENT OF CHINESE PLA GENERAL HOSPITAL

Drug resistant immune cells

Compositions and method of prevention and treatment for a subject in need comprising drug-resistant natural killer (NK) cells, which are effective for treating cancer when administered in conjunction with cytotoxic therapies. A method of treatment comprising administering to a subject in need thereof an effective amount of modified NK cells and a cytotoxic therapy. A purified cell composition comprising modified NK cells. A pharmaceutical composition comprising an effective amount of G101V mutated NK cells and venetoclax.
Owner:RGT UNIV OF CALIFORNIA

Mutant cell strain of ZNF717 L39V

The invention relates to a mutant cell strain of ZNF717 L39V, which is characterized in that CTG is mutated into GTG, leucyl (L) at the 39th site is mutated into valine (V), and the mutation sequence of the valine (V) is GGTGTCCTTGAGGAGGTAGCTGCACCTCGGGAGGAGTGGCAGGATGATGCTCAG. The mutant cell strain of ZNF717 L39V is characterized in that CTG is mutated into GTG, leucyl (L) at the 39th site is mutated into valine (V), and the mutation sequence of the valine (V) is shown in the specification. According to the gRNA sequence of the ZNF717 L39V and the ssDNA donor sequence of the ZNF717 L39V, which are designed by the invention, a mutation sequence can be obtained, the mutation efficiency is high, and a mutation site and a base sequence after mutation can be accurately controlled.
Owner:THE PEOPLES HOSPITAL OF GUANGXI ZHUANG AUTONOMOUS REGION

Purple KRAS mutation inhibitor and application thereof

The invention discloses a generic KRAS mutation inhibitor and application thereof, and belongs to the technical field of biomedicine. The inhibitor disclosed by the invention is a triaromatic ring compound, can selectively inhibit the proliferation of KRAS mutant cells by blocking the function of REG gamma-20S proteasome, and is used for treating KRAS mutant tumors or cancers. The method has a wide application prospect.
Owner:EAST CHINA NORMAL UNIV

Cell model and animal model for neurodevelopmental diseases caused by function acquisition type mutation of GABAAR as well as construction method and application of cell model and animal model for neurodevelopmental diseases caused by function acquisition type mutation of GABAAR

The invention belongs to the technical field of biology, and provides a cell model and an animal model for neurodevelopmental diseases caused by GOF (Gain of Function) mutation of GABAAR, and a construction method and application of the cell model and the animal model. The neurodevelopmental disease cell model and the animal model comprise GABRB3 gene point mutation cells, and the point mutation is that leucine at the 235th site is mutated into alanine. The neurodevelopmental disease cell model constructed by the invention has high disease relevance and stable expression, and can be used as a humanized cell model for in-vitro drug screening.
Owner:ARTIFICIAL INTELLIGENCE RES INST OF HEFEI COMPREHENSIVE NAT SCI CENT (ANHUI ARTIFICIAL INTELLIGENCE LAB)

Construction method and application of JAK2 V617F mutant cell model based on CRISPR / Cas9

The invention relates to the technical field of gene engineering, in particular to a construction method and application of a JAK2V617F mutant cell model based on CRISPR / Cas9, and the construction method specifically comprises the following steps: designing an sgRNA sequence based on a JAK2V617F mutation site; the method comprises the following steps: constructing a pX458-JAK2-sgRNA plasmid by taking a pX458 plasmid as a vector; an ssODN-Donor sequence is designed; a pX458-JAK2-sgRNA plasmid and an ssODN-Dornor sequence are respectively prepared into transfection complexes, the transfection complexes are transfected into THP1 cells, and after culture, extraction and identification, a JAK2V617F mutant cell model is successfully constructed. The invention not only solves the problem that in-vitro models of neutrophils and monocytes carrying JAK2V617F mutation cannot be constructed in the prior art, but also deeply reveals the mechanism of abnormal high expression of inflammatory factors of MPN patients, and promotes the screening and development of novel anti-inflammatory and anti-fibrosis drugs.
Owner:SHANXI MEDICAL UNIV

Application of mitochondrial vesicles in reduction of mitochondrial DNA deletion mutation

PendingCN122031523ASenses disorderMuscular disorderCell membraneErythrocytes membrane
The invention provides application of mitochondrial vesicles in reduction of mitochondrial DNA deletion mutation. The mitochondrial vesicles are prepared by wrapping mitochondria with erythrocyte membranes, the mitochondrial vesicles can be tested and verified to effectively reduce the mitochondrial DNA deletion mutation level in cells, metabolism and functions of mutant cells are improved, verification is further carried out in muscle cells of CPEO patients, and the clinical application prospect is wide. By implanting the mitochondrial vesicles, the mitochondrial DNA deletion mutation level in the CPEO patient muscle cells can be effectively reduced, which indicates that the mitochondrial vesicles have the potential of treating CPEO, and a new thought is provided for treating diseases related to mitochondrial DNA deletion mutation.
Owner:GUANGZHOU INSTITUTES OF BIOMEDICINE AND HEALTH CHINESE ACADEMY OF SCIENCES +1

Method for detecting bi-allelic gene edited cells based on CRISPR / Cas12a technology

A method for detecting bi-allelic gene edited cells based on CRISPR / Cas12a technology is provided. The method provides crRNA, a nucleotide sequence of which that binds target is SEQ ID NO: 6. The crRNA is transcribed from a transcription template in vitro; the transcription template is a product obtained by annealing a single stranded DNA molecule shown in SEQ ID NO: 10 and a single stranded DNA molecule shown in SEQ ID NO: 13. The method provides crRNA of CD71 gene and constructs a CRISPR / Cas12a system using the same for CRISPR / Cas12a detection, achieving the screening for CRISPR / Cas9 induced CD71 gene bi-allelic gene edited cells. This method is simple, easy, fast, and cost-effective for screening a large number of mutant cells.
Owner:AGSINO GENSOURCES CO LTD

A selective inhibitor for brca mutations and uses thereof

The application discloses a selective inhibitor for BRCA mutation and application thereof. Specifically, the application relates to a quinazolinone compound shown in a general formula (I) or a pharmaceutically acceptable salt or a solvate thereof, wherein the compound has better selectivity for BRCA mutation, has a good inhibition rate on the proliferation of BRCA mutant cells at a low concentration, and is superior to existing olaparib and AZD5305 and the like. Through a nude mouse tumorigenesis experiment, it is proved that the drug obviously shows an inhibitory effect on tumor growth at a low drug concentration, and has no obvious toxic side effects.
Owner:WEIFANG MEDICAL UNIV +3

Application of lncRNA SVIL-AS1 as a target in AKT1 E17K mutant tumors

This invention discloses the application of lncRNA SVIL-AS1 as a target in AKT1E17K mutant tumors, belonging to the field of molecular biology technology. This invention provides the application of lncRNA SVIL-AS1-related biomaterials in the preparation of products for regulating the function of AKT1E17K mutant cells. This invention verifies that SVIL-AS1 can specifically bind to AKT1E17K mutants and inhibit their phosphorylation level and kinase function, thereby inhibiting the proliferation of AKT1E17K mutant cells, revealing the role of SVIL-AS1 in the treatment of AKT1E17K mutant tumors. This invention applies lncRNA SVIL-AS1 to the treatment of AKT1E17K mutant tumors, not only providing a new source for the preparation of materials for the prevention and treatment of AKT1E17K mutant tumors, but also exploring new pharmaceutical value of lncRNA SVIL-AS1.
Owner:SUN YAT SEN MEMORIAL HOSPITAL SUN YAT SEN UNIV

Application of ZmZFP1 protein and coding gene thereof in regulation and control of plant root development

The invention discloses an application of ZmZFP1 protein and a coding gene thereof in regulation and control of plant root development, and provides an application of the ZmZFP1 protein or related biological materials thereof in regulation and control of plant root development, and the related biological materials are nucleic acid molecules capable of expressing the ZmZFP1 protein or expression cassettes, recombinant vectors, recombinant bacteria or mutant cell lines containing the nucleic acid molecules. The ZmZFP1 protein is a protein as shown in SEQ ID No.2 or a protein which has one or more nucleotide or amino acid differences with the protein as shown in SEQ ID No.2 and has the same function as the protein as the protein as shown in SEQ ID No.2. By knocking out ZmZFP1 or inhibiting ZmZFP1 expression of a corn mutant, the growth of a main root under low nitrogen stress treatment is obviously inhibited, which indicates that the gene responds to low nitrogen stress by regulating the growth of the main root, and the application provides a new germplasm resource for cultivating a new low nitrogen resistant corn variety, and has a wide application prospect. And a theoretical basis is laid for researching a mechanism of plant response to stress signals and a molecular mechanism of plant tolerance to adverse environments.
Owner:CHINA AGRI UNIV

Method for breeding poultry by heavy ion beam mutagenesis

This invention discloses a method for heavy ion beam mutagenesis breeding of poultry. To address the challenges of efficient, rapid, and safe breeding in poultry, this method utilizes heavy ion beam irradiation of poultry progenitor cells (PGCs) to induce radiation mutagenesis, constructing a mutant cell library. The PGCs in this library are then isolated into single cells to form monoclonal populations. Targeted deep sequencing is used to screen for positive PGCs with gene mutations from the S2-after monoclonal population, and the mutated gene is preliminarily identified. Positive PGCs are injected via microinjection into recipient embryos after their own PGCs have been ablated, resulting in chimeras. Individuals developed from these chimeras undergo molecular screening and identification. M1 generation individuals containing the identified mutated gene are then used for breeding to obtain offspring strains that stably inherit the mutated gene. This method is efficient, rapid, safe, and avoids the ethical and regulatory risks associated with gene editing technologies, making it of significant application value for mutagenesis breeding in poultry.
Owner:HUNAN ACADEMY OF AGRI SCI +4

Method of transposon insertion site sequencing capable of uniquely identifying insertions sites within repeated genetic elements

A method of transposon insertion sequencing (TIS) capable of resolving insertion sites in or around repeat elements, said method including the steps of; preparing a pool or library of mutant cells by
Owner:QUADRAM INSITUTE BIOSCI

Aminothiazole compound and application thereof as androgen receptor antagonist

The invention discloses an aminothiazole compound and an application thereof as an androgen receptor antagonist. The aminothiazole compound comprises pharmaceutically acceptable salts, solvates, prodrugs and isomers of the aminothiazole compound, and pharmaceutical compositions containing the aminothiazole compound and the pharmaceutically acceptable salts, the solvates, the prodrugs and the isomers of the aminothiazole compound. The aminothiazole compound has obvious antagonistic activity to AR, shows better biological activity in in-vivo and in-vitro biological evaluation, and is effective to an enzalutamide drug-resistant ARF876L / T877A two-point mutation model and a comparison caralutamide drug-resistant ARW741C mutant cell model. The percutaneous administration also shows the effect of promoting hair growth on a mouse alopecia model. Therefore, the compound can be used as an AR antagonist to prepare drugs for treating diseases related to androgen receptors, such as prostate cancer, metastatic prostate cancer, castration-resistant prostate cancer, breast cancer, ovarian cancer, androgen-derived alopecia and acne.
Owner:ZHEJIANG UNIV

Fungal expression systems with reduced volatile compounds

PCT designated stageWO2026125306A1FungiOxidoreductasesHeterologousOxygenase
The present invention relates to Aspergillus mutants with reduced or eliminated expression and / or activity of an endogenous psi-producing oxygenase C (PpoC) comprising in its genome one or more polynucleotide encoding a polypeptide of interest heterologous to the mutant cell, methods of producing a polypeptide of interest using said host cells, as well as the use of said cells in production methods to provide fermentation products comprising reduced volatile agents.
Owner:NOVOZYMES AS

A mutant strain of chlorella vulgaris easy to settle and break wall and its use

PendingCN122326384ABiotechnologyWild type
This invention relates to a Chlorella mutant strain that is easily separated by sedimentation and cell wall disruption, and its uses, in the fields of biology and bioengineering. The Chlorella is... Chlorella pyrenoidosa GA, deposited on March 23, 2026 at the China Center for Type Culture Collection (CCTCC), accession number CCTCC NO: M2026500. This Chlorella mutant strain showed no difference in growth compared to the wild type under all culture conditions, but exhibited a significantly increased protein accumulation. Furthermore, the mutant cells settled more easily, with significantly higher natural sedimentation and centrifugation efficiencies under the same treatment conditions compared to the wild-type strain. Cell disruption was also significantly easier, facilitating digestion and absorption by predators. The mutant strain described in this invention has broad application prospects in the production of Chlorella-related products and aquaculture.
Owner:YANGZHOU UNIV

HDAC8 gene knockout MDBK cell line as well as construction method and application thereof

PendingCN121610456ASsRNA viruses positive-senseHydrolasesBovine Viral Diarrhea VirusesReplication competent virus
The invention discloses an HDAC8 gene knockout MDBK cell line as well as a construction method and application thereof. According to the method, a CRISPR / Cas9 technology is utilized, specific gRNA is designed aiming at a second exon of a cattle HDAC8 gene, CRISPR expression plasmids are constructed, adherent MDBK cells are transfected, and HDAC8 homozygous frame-shift mutant cell lines KOHDAC8-1 (4bp deletion) and KOHDAC8-2 (1bp insertion) are obtained through puromycin screening and monoclonal separation. An identification result shows that HDAC8 knockout obviously promotes replication of the bovine viral diarrhea virus (BVDV), the expression level of NS3 mRNA and protein of the virus is increased, the virus titer is obviously improved, and the cell growth rate is not obviously influenced. The cell line provided by the invention can be used as an efficient proliferation matrix of the BVDV, is used for producing inactivated vaccines for bovine viral diarrhea, and effectively improves the yield and quality of the vaccines.
Owner:SHANGQIU NORMAL UNIVERSITY

LLC cell mEgfrp.L860R mutant strain Mus musculus and application thereof

The invention discloses an LLC cell mEgfrp.L860R mutant strain Mus musculus and application of the LLC cell mEgfrp.L860R mutant strain Mus musculus, and belongs to the technical field of cell engineering. According to the LLC cell mEgfrp.L860R mutant strain Mus musculus, on the basis of an LLC cell line, by accurately introducing EGFR typical mutation, the clinical state of an EGFR mutant NSCLC patient is successfully simulated. Compared with a traditional EGFR mutant cell model, the LLC cell mEgfrp.L860R mutant strain Mus musculus not only has a stable EGFR mutant phenotype, but also can well reflect the dynamic change of the immune microenvironment of tumor cells in the EGFR-TKI process, provides a powerful in-vitro and in-vivo experimental tool for researching the construction of the tumor immune microenvironment using EGFR-TKI, and has an important clinical transformation value.
Owner:AFFILIATED HOSPITAL OF NANTONG UNIV

P2RY4 gene targeted knockout sgRNA and application thereof in inhibition of pseudorabies virus replication

The invention discloses sgRNA for targeted knockout of a P2RY4 gene and application of the sgRNA in inhibition of pseudorabies virus replication, and belongs to the field of gene engineering. According to the present invention, sgRNA is designed according to the P2RY4 gene sequence, and is inserted into a PX459 vector so as to construct a PX459-sgRNA-P2RY4 recombinant plasmid; the plasmids are introduced into IPEC-J2 cells through electrotransfection, and a P2RY4 gene knockout mutant cell strain is obtained through resistance screening; experiments prove that the P2RY4 gene knockout mutant cell strain has a certain inhibition effect on the infection of the pseudorabies virus. Therefore, the invention provides a new target for research, development and application of anti-pseudorabies virus drugs, and has important significance for disease control in pig industry.
Owner:AGRO BIOLOGICAL GENE RES CENT GUANGDONG ACADEMY OF AGRI SCI

A class of deletion mutants, cell slides, kits, and applications for the detection of GFAP autoantibodies

This invention discloses a class of deletion mutants, cell slides, kits, and applications for the detection of GFAP autoantibodies. The invention constructs multiple GFAP recombinant mutants. Experiments show that when any nucleotide at a multiple of 3 from the 5' end of the GFAP nucleotide sequence to positions 186-309 is deleted, these deletion mutants are transformed into expression cells to prepare GFAP mutant cell slides. Using these GFAP mutant cell slides to detect serum and cerebrospinal fluid from patients, the long protrusion signal disappears, thus solving the problem of long protrusion signals in the detection of GFAP autoantibodies. This effectively solves the background signal problem encountered during detection, thereby improving the reliability of GFAP autoantibody diagnosis, especially the specificity of detection. It effectively solves the technical problem in existing GFAP autoantibody detection methods where the presence of background signals leads to blurred staining images, resulting in false positives or false negatives.
Owner:SHAANXI MYBIOTECH CO LTD

Targeted modified TNF family members

The present invention relates to a modified cytokine of the TNF superfamily, with reduced activity to its receptor, wherein said modified cytokine is specifically delivered to target cells. Preferably, said modified cytokine is a single chain variant of the TNF superfamily, even more preferably, one or more of the chains carry one or more mutations, resulting in a low affinity to the receptor, wherein said mutant cytokine is specifically delivered to target cells. The targeting is realized by fusion of the modified cytokine of the TNF superfamily to a targeting moiety, preferably an antibody or antibody-like molecule. The invention relates further to the use of such targeted modified cytokine of the TNF superfamily to treat diseases.
Owner:UNIVERSITY OF MONTPELLIER +4

Compositions and methods for inducing antigen-specific immune against KRAS mutated cells

Provided herein are therapeutic nucleic acid molecules for managing, preventing and / or treating neoplastic diseases or disorders caused by or associated with oncogenic mutations of the KRAS gene. Also provided herein are therapeutic compositions, including vaccines and lipid nanoparticles, comprising the therapeutic nucleic acids, as well as related methods of treatment and uses.
Owner:ABOGEN BIOTECHNOLOGY (SHANGHAI) CO LTD

SiRNA for treating UMOD gene mutant autosomal dominant hereditary renal tubular interstitial nephropathy

The invention discloses siRNA for treating UMOD gene mutant autosomal dominant hereditary renal tubular interstitial nephropathy, and belongs to the field of biomedicine. The siRNA comprises a positive-sense strand and an antisense strand, and the nucleotide sequences of the positive-sense strand and the antisense strand are SEQ ID NO.1 and SEQ ID NO.2 respectively. Compared with the prior art, the UMOD point mutation mouse model is successfully constructed, and the model completely simulates typical disease phenotypes of ADTKD-UMOD patients. In-vivo and in-vitro functional verification shows that Umod mutated mice and cell models can activate unfolded protein reaction and cell ferroptosis and apoptosis for the first time. The invention further adopts targeted UMOD mRNA for intervention by using siUMOD, and the result shows that siRNA can inhibit Umod mutant cell ferroptosis and cell apoptosis, relieve endoplasmic reticulum stress caused by mutation, improve mouse renal function and delay disease progression at the same time. According to the application, an innovative and feasible method is provided for treatment of ADTKD-UMOD, and a universal platform technology is provided for single-gene hereditary nephropathy.
Owner:SOUTHEAST UNIV

Application of nuclear localization GDOWN1 in preparation of medicine for treating cancer

The invention discloses application of nuclear localization GDOWN1 in preparation of medicines for treating cancers, and relates to the technical field of biological medicines. The engineering modified GDOWN1 protein is localized in a cell nucleus, a brand new anticancer strategy is constructed, the core advantage of the GDOWN1 protein is that the limitation of the existing therapy is broken through, and synergistic anticancer is realized through a double-locking mechanism: on one hand, a p53-p21 pathway is activated to inhibit the activity of cyclin kinase, and on the other hand, the GDOWN1 protein is activated; on the other hand, the transcription process is regulated and controlled to promote dephosphorylation of RB family proteins and activate the transcription inhibition activity of the RB family proteins, and a powerful synergistic effect of cell cycle arrest is formed. The effect is not influenced by the state of the TP53 gene, and a strong proliferation inhibition effect is shown in wild type and mutant type cell strains of chronic myelogenous leukemia, breast cancer and colorectal cancer. In addition, the nuclear localization GDOWN1 has an effective broad-spectrum anti-tumor potential in both p53 wild type and mutant type cancers.
Owner:LANZHOU UNIV

STAT3 mutant cell product and application thereof

The invention discloses an STAT3 mutant cell product and application thereof, and belongs to the cross technical field of genetic engineering and tumor immunotherapy. According to the application, the fact that STAT3 function acquired mutation promotes CAR-T anti-tumor reaction is found for the first time through saturated mutation screening, cell experiments and animal experiments further prove that activation of STAT3 can relieve CAR-T cell immune depletion, and the in-vivo and in-vitro killing ability of CAR-T cells on tumor cells is remarkably improved, so that the anti-tumor treatment effect is improved, and the application of the CAR-T anti-tumor drug is developed. The invention provides a new therapeutic target and therapeutic strategy for the technical field of tumor immunotherapy, and has important scientific significance and clinical application value.
Owner:ZHEJIANG UNIV