7 results about "Skeletal disorder" patented technology

The application discloses a functional composition for improving bone and joint health, a conditioner and application. The functional composition comprises a first active component and a second active component; the first active component comprises elastin peptide, haematococcus pluvialis and ergothioneine; and the second active component comprises one or more of houttuynia cordata and non-denatured type II collagen. The application realizes the protection effect on joint, cartilage and bone health by scientific matching of the components and synergistically improving the glycosaminoglycan level in chondrocytes and the osteocalcin level in osteoblasts. Meanwhile, the components in the functional composition for improving bone and joint health are natural and have good biocompatibility, and have no obvious side effects, so that the application provides a kind of drug or a substitute for the treatment and prevention of bone diseases.

Embodiments of the disclosure include methods and compositions related to modulation of bone using particular fibroblasts. The modulation includes reducing osteoclast activity and / or activation and / or stimulating osteoblast activity. In particular cases, bone is modulated in an individual with a bone condition, such as osteoporosis. Particular fibroblasts may be delivered to reduce inflammatory cytokine production including RANK ligand.

Provided herein are compounds that are useful for or methods of inhibiting β-catenin or disrupting the interaction between β-catenin and T-cell factor 4, which are useful in the treatment of diseases or health conditions, such as cancer, neurodegenerative, a metabolic disease, a cardiovascular disease, fibrosis, and a bone disease. In one aspect, the compounds have Formula 1 wherein R1 is —(CR42)mXR5; R2 is alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, heterocycloalkenyl, aryl, aralkyl, heteroaralkyl, or heteroaryl; and R3 is —(CR62)nR7.

The invention relates to the treatment of bone disorders. In particular, the invention is directed to the use of a dosing holiday to help overcome the resistance to anti-sclerostin antibodies which develops over time when a plurality of doses of antibody are given to a subject. By giving the subject to be treated such a dosing holiday, the subject may subsequently display an increased response to a subsequent dose of the anti-sclerostin antibody. The subject may be given multiple cycles of a batch of at least two doses of anti-sclerostin antibody and a dosing holiday. In some instances, the subject may be monitored to help determine when to give the dosing holiday. Further, the subject may be given a different treatment for the bone disorder during the dosing holiday from the anti-sclerostin antibody.

The present invention relates to a novel therapeutic agent capable of treating muscle diseases, metabolic diseases, and bone diseases by simultaneously inhibiting the activin type II receptor and myostatin. Specifically, the invention relates to a bispecific protein comprising an anti-ActRII antibody and an anti-Myostatin antibody, and the use thereof. The simultaneous inhibition of the activin type II receptor and myostatin according to the present invention exhibits excellent effects of muscle growth and bone differentiation as well as weight loss; thus, it resolves the problem of muscle loss, which is a side effect of existing anti-obesity treatments, and can effectively improve various metabolic diseases. Therefore, the bispecific protein of the present invention can be utilized in various fields for the improvement and treatment of muscle diseases, metabolic diseases, and bone diseases.

The present invention relates to a pharmaceutical composition for treating or preventing bone diseases, comprising platelets and, more specifically, to a pharmaceutical composition for treating or preventing bone diseases, comprising artificial platelets having an increased concentration of any one growth factor selected from the group consisting of PDGF-AA, PDGF-BB, EGF, TGF-β, bFGF, and VEGF, thereby promoting the synthesis of chondrocytes, inhibiting inflammatory responses, and reducing the expression of extracellular matrix-degrading enzymes, thus enabling the recovery of bone and joint tissue.

: The present invention provides a DNA aptamer having a length of up to 80 nucleotides, preferably up to 40 nucleotides, and being or containing the sequence: GGGATACAGGGCTXTGTCTATGGTGTGGATGGCGGATACC (SEQ ID NO. 1), wherein X is T or A, and wherein one to three deoxynucleotides may optionally be modified by fluorination, and / or wherein one or more of deoxyguanosines G10, G22 and G31 may optionally be modified by replacing H2´ of the sugar moiety with F, O-methyl, O-methoxyethyl, or by forming a covalent methylene or ethylene bridge between 2'-O and 4'-C, and / or wherein one or more of G10, G22 and G31 may optionally be modified by replacing the hydrogen atom at the C8 carbon atom of the guanine base with bromine atom or with methyl, and / or wherein the phosphodiester linkage may optionally be replaced by phosphorothioate linkage in one or more nucleotides. The DNA aptamers according to the invention are selective FGFR1 inhibitors and are useful in the treatment of skeletal disorders, developmental disorders, and cancers caused by aberrant FGFR1 signaling.