15 results about "Luffa aegyptiaca" patented technology

The invention discloses a towel gourd salt stress response gene LcNACJA2L as well as an expression vector and application thereof. Through RNA-seq and WGCNA analysis, the salt stress response LcNACJA2L gene is cloned from towel gourds, the nucleotide sequence of CDS of the salt stress response LcNACJA2L gene is shown as SEQ ID No.2, and the amino acid sequence of protein coded by the salt stress response LcNACJA2L gene is shown as SEQ ID No.3. The LcNACJA2L gene is overexpressed in arabidopsis thaliana, compared with wild arabidopsis thaliana, a transgenic arabidopsis thaliana strain overexpressed with the LcNACJA2L gene is obviously longer in root length than WT under salt stress, leaves are also larger than WT, the yellowing degree of the leaves is lower than WT, and it is proved that overexpressed with the LcNACJA2L gene in a plant can significantly improve the salt stress resistance of the plant. The method has application prospects in the aspects of improving the salt stress resistance of plants, assisting in breeding salt stress resistant plant varieties and the like.

The invention discloses a method for producing lucid ganoderma from sweet-scented osmanthus by-products and interplanting the lucid ganoderma and towel gourds, which comprises the following steps: S1, preparing a lucid ganoderma culture medium and a fungus bag, namely crushing and mixing sweet-scented osmanthus wood chips, sweet-scented osmanthus seed crushed materials, oyster powder and towel gourd stems according to a ratio, braising for half an hour, fishing out, bagging and sterilizing to obtain a sterilized culture medium; inoculating and cultivating bacteria until hyphae grow over the substrate; s2, a ganoderma lucidum growing field is built and managed, in mid-to-late April, the material bags subjected to fungus growing are moved into a ganoderma lucidum shed, and ganoderma lucidum growing management is conducted in a semi-bag-removing mode; s3, interplanting the towel gourds; s4, ganoderma lucidum growing environment control: controlling the temperature in the ganoderma lucidum shed to be less than 32 DEG C, and controlling the humidity in the ganoderma lucidum growing management period to be greater than 90%; step S5, harvesting and post-processing. The interplanting mode improves the land utilization rate per unit area, the ganoderma lucidum and the towel gourds grow synergistically, the yield of the ganoderma lucidum and the towel gourds is stable, the quality is guaranteed, effective components of the ganoderma lucidum are completely reserved, the planting income per unit area is greatly increased, and the method is suitable for large-scale application and popularization.

Cosmetic coated particles having, on at least a portion of the surface of particles (B), a coating layer comprising an ester compound (A) and a powder of leaves of at least one plant selected from the genera Camellia, Olive, Diospyros, Curcuma, Quercus, Luffa, Perilla, Ginkgo, Equisetum, Artemisia, Cycad, Mulberry, and Eucommia, wherein the ester compound (A) is an ester compound of a C8-28 fatty acid and a sugar compound formed by combining two or more monosaccharides.

The utility model discloses an adjustable loofah planting supporting device which comprises a fixing rod and a plurality of clamping rings arranged on the fixing rod, a fixing disc is arranged on the lower sides of the clamping rings, and supporting rods are arranged at the left end and the right end of the lower side of the fixing disc respectively. A rotating shaft is arranged at the middle connecting position of the two supporting rods and the fixing disc, a connecting plate is arranged in the middle of the outer side of each supporting rod, a round rod is arranged in the middle of each connecting plate, and connecting ends are arranged at the tail ends of the front side and the rear side of the fixing rod correspondingly. Clamping rings are arranged on the front side and the rear side of the fixing rod respectively, and the time and energy spent by a planter on managing towel gourd vines can be saved through the flexible adjusting function and the simple operation mode. For example, when large-area towel gourds are planted, all vines can be rapidly supported and managed by using the supporting device easy to adjust, and the overall planting efficiency is improved.

The invention discloses an Indel molecular marker related to the browning character of towel gourd pulp, a detection primer and application of the Indel molecular marker and the detection primer, and belongs to the field of molecular assisted genetic breeding. The Indel molecular marker is located at the 8045208 site of the No. 5 chromosome of a luffa cylindrica reference genome, the site has a 15bp insertion / deletion variation, and the genotype (homozygous insertion type / heterozygous vs. Homozygous deletion type) is highly consistent with the browning-resistant phenotype. A detection primer pair developed on the basis of the marker can accurately predict the browning characteristic of the fruit of the towel gourd through DNA detection in the early growth stage of the towel gourd, and transformation from phenotype selection to genotype selection is achieved. The invention provides a brand-new, accurate and reliable molecular tool for browning-resistant breeding of towel gourds.

The invention relates to the technical field of loofah pollination devices, in particular to a greenhouse cultivation loofah pollination device which comprises a pollination device body and a pollination tank, a loading cavity is formed in the pollination device body, an air inlet insertion pipe is arranged at the bottom of the loading cavity, and a handle is installed on the side wall of the pollination device body. A manual air pump is arranged in the handle, a push block is connected to the manual air pump, the air outlet end of the manual air pump is communicated with the air inlet insertion pipe through a connecting pipe, a pollination tank is installed in the loading cavity, a pollination cavity is formed in the pollination tank, and an air uniformizing opening is formed in the bottom of the pollination cavity; the invention provides a pollination device for greenhouse cultivation of towel gourds, and aims to realize convenient, efficient and uniform pollination operation, reduce labor intensity and improve the fruiting rate and fruit quality of the towel gourds.

The application discloses a method for creating luffa double haploid by distant hybridization, which comprises the following steps: applying brassinolide water solution to the pistil of luffa female flower which will bloom the next day; the next day, pollinating the luffa female flower to which the brassinolide water solution is applied by using the male flower of winter melon, and at the same time, applying thidiazuron water solution to the ovary and pistil of the luffa female flower; after the pollination, bagging and isolating the female flower; 3-6 hours and 20-26 hours after the pollination, applying thidiazuron solution to the ovary and the base of the fruit stalk; after harvesting the seed melon, taking the relatively full seeds to germinate and sow to obtain regenerated plants; training and transplanting the regenerated plants, and then normally cultivating and managing the plants. The thidiazuron and the brassinolide are combined to be used for distant hybridization induction, stimulate the embryo development, and improve the fruit setting rate; through the multiple thidiazuron treatment, the chromosome doubling is induced, the luffa double haploid is directly obtained, and the problem of low efficiency of the luffa double haploid is solved.

The invention relates to streptomyces spectabilis AMC3-4 capable of preventing and treating towel gourd fusarium wilt, which is preserved in China General Microbiological Culture Collection Center (CGMCC) on November 24, 2025, and has a preservation number of CGMCC No.36755. The invention also relates to an application of the streptomyces spectabilis AMC3-4 in preventing and treating towel gourd fusarium wilt. The streptomyces spectabilis AMC3-4 strain disclosed by the invention has a very strong inhibition effect on pathogenic bacteria of towel gourd fusarium wilt, and fermentation liquor of the streptomyces spectabilis AMC3-4 strain contains various metabolites with antibacterial effects. The prevention and treatment effect of the towel gourd potted plant treated by the AMC3-4 fermentation liquor is 47.62%. Compared with a chemical pesticide, the natural strain separated from soil has no toxic or side effect and no residue on soil ecology, so that the strain has potential commercial development and application values in biological prevention and control practice of diseases.

The present invention refers to a root extract of the plant Luffa cylindrica, wherein said root extract is enriched in bryonolic acid, wherein the bryonolic acid represents at least 10% by weight, relative to the total weight of the dry extract. The present invention refers also to compositions comprising said root extract.

This invention relates to a *LaCAD* gene, protein, recombinant vector, genetic transformation method, and its application in *Luffa cylindrica*, belonging to the fields of plant tissue culture and transgenic technology. The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the recombinant vector is pCAMBIA1300-GFP-CAD. This invention also provides a genetic transformation method for *Luffa cylindrica* and the application of the *Luffa cylindrica* cinnamyl alcohol dehydrogenase gene in increasing the lignin content of *Luffa cylindrica*. The method of this invention can increase the lignin content in *Luffa cylindrica* by 4-6 times.

A composition includes the following active components: component (1): at least one selected from the group consisting of Ligustrum fruit, yerbadetajo herb, Lilium bulb, Polygonatum Rhizome, Lycium fruit, Sesamum indicum, and black soybean; component (2): at least one selected from the group consisting of Suberect spatholobus stem, Longan aril, wild turmeric, zedoary root, Luffa vegetable sponge, Sparganium rhizome, safflower, Artemisia anomala, common fenugreek seed, Dipsacus japonicus root, Drynaria herb, sea horse, Cynomorium herb, and Astragalus Seed; component (3): at least one selected from the group consisting of tea leaf, plantago seed, plantago herb, coix seed, small red-bean, corn silk, Lophatherum herb, Benincasa seed, mallow seed, knotgrass, and Lygodium spore; and component (4): at least one selected from the group consisting of Dioscorea japonica Thunberg, Eleutherococcus senticosus Rhizome, honey, oriental bush cherry, ginger root, ripe tangerine peel, unripe tangerine peel, immature orange, malt starch syrup, jujube fruit, and non-glutinous rice.

The invention provides a towel gourd radiation induced embryoid seedling culture medium and a towel gourd double haploid creation method, and belongs to the technical field of breeding. The invention provides a loofah radiation mutagenesis embryoid seedling culture medium. The loofah radiation mutagenesis embryoid seedling culture medium comprises 4.74 g / L of an MS culture medium, 30 g / L of sucrose, 0.04 mg / L of thidiazuron, 0.225 mg / L of 6-benzylamino adenine and 7 g / L of agar. The radiation induced embryoid seedling culture medium for the towel gourd is used for culturing the radiation induced embryoid of the towel gourd, so that the radiation induced embryoid seedling of the towel gourd can be promoted, and the grown plant is identified as the double haploid of the towel gourd. Technical support is provided for creation of double haploids of towel gourds, high-quality parents are provided for cultivation of new varieties of towel gourds, and the creation process of the new varieties of towel gourds is accelerated.

The application discloses a molecular marker C9-28 closely linked with a luffa flower color gene, a detection method and application thereof, and the sequences of forward and reverse primers of the molecular marker are as follows: 5' AACGCTAAATGGATGGTTGG 3' and 5' TCACTTTTATTAATGTTTGGTCAAATG 3'. In an F2 population, the molecular marker C9-28 can amplify a 141bp single band in a luffa single plant with light yellow flowers, and can amplify a 152bp single band or 141bp and 152bp double bands in a luffa single plant with yellow flowers. The molecular marker C9-28 disclosed by the application can be used for fine positioning of the luffa flower color gene and molecular marker assisted selection breeding, has the advantages of high accuracy, good repeatability, convenient identification and the like, and has important theoretical and practical guiding significances for accelerating luffa breeding.

The invention belongs to the field of towel gourd planting, and relates to an ecological three-dimensional planting and breeding method and system for high-sugar towel gourds. The ecological three-dimensional planting and breeding method for the high-sugar towel gourds comprises the steps that planting and breeding plots are constructed in autumn and winter of the At the end of February, the planting and breeding plots are watered and disinfected; from the middle ten days of March to the middle ten days of April, round-head tadpole seedlings are put; in early April, towel gourd seedlings are cultivated through floating seedling raising hole trays, and in the middle of April, the towel gourd seedlings are transplanted into non-woven fabric planting bags placed in vegetable planting areas of planting and breeding plots; in the middle ten days of May, towel gourd vines are guided to grow to form a shading shed frame; from late June to September, disease prevention and control and field management of frogs are carried out, and towel gourds are harvested and / or frogs are captured and sold; in October, towel gourd vines are cleaned, and frog overwintering management is carried out. According to the method, efficient land utilization and green production collaboration are achieved, dependence on pesticides and chemical fertilizers is reduced, non-point source pollution is controlled from the source, high-sugar loofah and frog products with zero pesticide residues are produced, and economic and ecological benefits are improved.

The invention provides a loofah sheltered part leaf area segmentation complementation and lossless estimation method. The method comprises the following steps: step 1, acquiring a loofah plant image by using a monocular camera; 2, predicting image depth information by using a MoGe2 model; step 3, carrying out blade instance segmentation by using a Ground SAM model; step 4, detecting sheltered leaves based on the depth information and the segmentation result; step 5, performing shape completion on the sheltered blade by using a DeepSDF model; 6, calculating the three-dimensional leaf area of each leaf; and 7, storing and analyzing the leaf data, and providing a nutrition management decision. The problems that leaf shielding cannot be treated and destructive sampling is needed are solved, high-precision, lossless and real-time leaf area monitoring is achieved, the method has the advantages of being high in practicability, contour complementation precision and background environment interference resistance, reference is provided for physiological, biochemical and genetic breeding and efficient cultivation research of towel gourds, and the method is worthy of popularization and application. And an effective technical support is provided for precision agriculture.