16 results about "Lymphocyte Numbers" patented technology

The invention relates to the technical field of biological medicines, in particular to a maggot alcohol extract for improving chemotherapy immune injury, a preparation method of the maggot alcohol extract and application of the maggot alcohol extract in preparation of medicines, health-care products or functional foods for preventing or treating immune injury caused by chemotherapy medicines. It is found for the first time that the maggot alcohol extract has a remarkable protection effect on immune injury caused by chemotherapeutic drugs such as cyclophosphamide, the number of leukocytes and lymphocytes can be effectively increased, and immune organ atrophy is relieved. The maggot alcohol extract disclosed by the invention can be used for preparing medicines, health care products or functional foods for preventing or treating immune injury caused by chemotherapy, has the characteristics of multiple target spots, high efficiency and low toxicity, is simple and stable in preparation process, and has good development and application prospects.

The invention discloses a method for establishing an antibody-mediated autoimmune encephalitis prognosis evaluation column diagram model. The method comprises the following steps: collecting patient demographic data, clinical manifestation, vEEG, multi-mode MRI, cognition and emotion scale, blood and cerebrospinal fluid assay and follow-up data; screening independent risk factors and protection factors through single-factor and multi-factor binary Logistic regression; and establishing a column graph prediction model according to the screened factors, and evaluating the performance of the model through an ROC curve, a correction curve and DCA. The model shows abnormal mental behaviors, the epileptic seizure type FBTCS is an independent risk factor of poor prognosis, normal number of neutrophils in blood is a protection factor, marginal system atrophy is an independent risk factor of transformation of chronic epilepsy, and normal number of lymphocytes in blood is a protection factor. The method can provide quantitative and visual individualized prognosis evaluation for the antibody-mediated autoimmune encephalitis patients, and can assist in early precise diagnosis and treatment.

This invention belongs to the field of traditional Chinese medicine technology, specifically relating to a traditional Chinese medicine composition for tonifying vital energy and promoting blood circulation, its preparation method, and its application. The traditional Chinese medicine composition of this invention, by weight, comprises: 6-15 parts of raw ginseng, 10-15 parts of epimedium, 10-20 parts of atractylodes macrocephala, and 6-15 parts of prepared licorice root. This traditional Chinese medicine composition has the effects of greatly tonifying vital energy, strengthening the spleen, and warming the kidneys. It can be used to treat fatigue and susceptibility to COVID-19, and also to treat symptoms such as fatigue, poor appetite, abdominal distension, and belching caused by spleen and stomach qi deficiency. Clinical studies have found that this traditional Chinese medicine composition can significantly increase the lymphocyte count in patients, improve their immunosuppressive state, thereby significantly improving the fatigue symptoms in patients with COVID-19 and achieving the goal of effectively treating COVID-19.

The invention relates to a method for increasing the number of lymphocytes by using an IL-7 fusion protein in a tumor. The present invention relates to a method of increasing the number of lymphocytes in a subject in need thereof, comprising administering to the subject (i) a modified interleukin-7 (represented by formula (I)): A-IL-7 wherein A is an oligopeptide consisting of 1 to 10 amino acid residues and IL-7 is a polypeptide capable of binding to the IL-7 receptor; or (ii) an interleukin-7 fusion protein comprising: (a) the modified interleukin-7; (b) a second domain comprising an oligopeptide having from 1 to 10 amino acid residues, the oligopeptide comprising methionine, glycine, or a combination thereof; and (c) a third domain that extends the half-life of the interleukin-7 fusion protein.

The invention relates to the technical field of traditional Chinese medicines, in particular to application of a traditional Chinese medicine composition in preparation of a medicine for preventing and / or treating chronic obstructive pulmonary disease. The traditional Chinese medicine composition comprises antelope horn powder, pearl powder, bezoar, stiff silkworm, cinnabar, amber, arisaema cum bile, borneol and rhizoma acori graminei oil. The traditional Chinese medicine composition provided by the invention can be used for remarkably enhancing the lung function, improving the airway limitation condition and improving the symptoms such as tachypnea, irregular rhythm, cough and asthma; the total number of leukocytes, the number of lymphocytes, the number of neutrophils and expression of inflammatory factors are reduced, airway inflammation is improved, and therefore the chronic obstructive pulmonary disease is treated in a multi-target mode.

The invention relates to a plant extraction complexing agent as well as a preparation method and application thereof. The plant extraction complexing agent is prepared from the following raw material components: rhizoma zingiberis, flos caryophylli, cortex cinnamomi, herba schizonepetae, fructus evodiae, radix aucklandiae, pepper, fennel, herba asari, pericarpium zanthoxyli, fistular onion stalk and radix ginseng. The hot-pungent / warm-pungent herbal medicine plants are selected and contain rich volatile oil, and sesquiterpenoids, monoterpenoids and aromatic compounds contained in the latter have a transdermal penetration enhancing effect, are suitable for in-vitro application, have the effects of stimulating an immune system, resisting inflammation, resisting viruses, easing pain and the like and are prepared into the instant granules through a special proportion formula. When in use, the sauna / atomization mode is utilized to promote the active ingredients to enter the body to stimulate the immune system so as to achieve the anti-inflammatory and anti-virus effects. The plant extract complexing agent provided by the invention can increase the total number of leukocytes, increase the number of lymphocytes and adjust the percentage distribution of unbalanced neutrophils and lymphocytes to tend to be normalized, and the effect shows a good dose-effect relationship.

The invention relates to the technical field of pathological image processing and medical artificial intelligence auxiliary diagnosis, and discloses a colorectal cancer prognosis analysis system and method fusing tissue and block characteristics, and the system comprises an image block cutting and standardization module which generates a standardized image block set under different multiplying power; the ResNet50 classifier module is used for carrying out organization classification on the image blocks; the tissue type specific feature extraction module is used for extracting multi-scale survival correlation features; the tissue spatial feature extraction and quantitative analysis module is used for reconstructing a multi-tissue type distribution diagram and calculating quantitative spatial features such as the number of lymphocytes and the intraperitoneal ratio after morphological repair; and the multi-modal feature fusion and survival prediction module is used for fusing the pathological deep features, the spatial segmentation features and the clinical data, and outputting an individualized prognosis risk score by using a survival model. According to the method, a macrostructure and microcosmic details are effectively integrated, and the accuracy and interpretability of colorectal cancer survival risk layering are improved.

This application discloses a white blood cell detection method for a blood cell analyzer. The method involves using a first detection module to detect white blood cell samples and obtain a white blood cell histogram. The count of basophils is then calculated from the white blood cell histogram. A second detection module then detects the white blood cell samples and obtains a scatter plot showing the two-dimensional distribution of four cell types, yielding the numbers of monocytes, neutrophils, and eosinophils. Finally, the five-part differential ratio of white blood cells is calculated based on the numbers of lymphocytes, monocytes, neutrophils, eosinophils, and basophils. This method can accurately detect various cell types within white blood cells. Furthermore, the calculation method is simple and cost-effective, thus achieving accurate detection results at a low cost.

1. A method for increasing lymphocyte count in a subject in need thereof, comprising administering to the subject (i) a modified interleukin-7 of the following formula (I): A-IL-7, wherein A is an oligopeptide consisting of 1 to 10 amino acid residues, and IL-7 is a polypeptide capable of binding to an IL-7 receptor; or (ii) an interleukin-7 fusion protein comprising: (a) a modified interleukin-7, (b) a second domain containing an oligopeptide having 1 to 10 amino acid residues consisting of methionine, glycine, or a combination thereof; and (c) a third domain that extends the half-life of the interleukin-7 fusion protein.

The application discloses application of Ms4a1 in peripheral blood leukocytes in calculation of high-energy neutron radiation dose, and relates to the technical field of biological detection. The application focuses on the biological effect and damage mechanism of neutron radiation, and potential biomarkers under dose gradient are screened. The LD50 and LD100 of mice under neutron radiation are determined as 8 Gy and 12 Gy respectively. The damage degree of radiation-sensitive organs such as spleen and intestinal tract is aggravated with dose gradient. The number of lymphocytes in the blood system is significantly reduced with dose, and can be used as an evaluation index of radiation damage. Cytokines such as IL-6 and IL-10 are significantly up-regulated, which indicates the inflammation and immune regulation mechanism. Ms4a1 is finally screened as a potential key gene, and the expression amount of Ms4a1 changes significantly before and after irradiation, and has very high sensitivity. The method can realize rapid and objective estimation of the neutron radiation dose by detecting the expression amount of Ms4a1 in peripheral blood leukocytes and substituting the dose-effect function, and has clinical transformation value.

The application discloses CD147-shRNA and application thereof in preparation of immunotherapy drugs, a base sequence of the shRNA is GCAATCACCAATAGCACTGAA; the shRNA sequence for silencing CD147 gene expression is cloned into a lentivirus vector to obtain a recombinant lentivirus particle containing the shRNA sequence, and a recombinant lentivirus for silencing CD147 expression is constructed; the obtained recombinant lentivirus is used for infecting tumor cells to realize the purpose of silencing CD147 gene expression. The shRNA sequence can significantly inhibit the expression of CD147 gene mRNA and protein levels in melanoma and lung cancer cells, increase the expression of chemotactic factor CCL5 and lymphocyte chemotaxis in vitro, increase the number of tumor infiltrating lymphocytes in vivo, inhibit tumor growth, and synergistically enhance the efficacy of immunotherapy for inhibiting tumor growth.

This invention discloses the polypeptide fusion protein CP13138P and its application in tuberculosis prevention. Specifically, it discloses a fusion protein comprising tandem HTL, CTL, and B-cell epitopes, CTB, Pam2Cys, and PADRE. This invention screened 34 epitopes targeting Mycobacterium tuberculosis, which exhibit excellent immunogenicity and antigenicity, are non-toxic and non-sensitizing, and have high population coverage. In vitro experiments demonstrate that CP13138P can stimulate an immune response in human peripheral blood mononuclear cells (PBMCs), increasing IFN-γ in PBMCs. + The number of T lymphocytes is significantly increased, and they secrete significantly high levels of more than a dozen cytokines, including G-CSF, making them a dominant protective antigen. CP13138P, as a vaccine, has advantages such as simple preparation method, low cost, high yield, and enhanced safety. This invention has significant value for the prevention and treatment of active tuberculosis and latent tuberculosis infection.

The invention discloses a method for screening dairy cow milk production performance and blood character markers and application. The method comprises the following steps: performing GWAS preliminary screening by a FarmCPU method, performing GWAS analysis on a gene level, constructing a geneHapR haplotype module, and performing correlation analysis. According to the present invention, it is found for the first time that four modules exist in the LOC112441463 gene of the chromosome 15, wherein the modules Block2 and Block4 are significantly related to the number of lymphocytes and the milk yield of 305 days; h001 (CT / TA) in Block2 and H001 (GT / AC) in Block4 are haplotype dominant allelotype, the number of lymphocytes carrying haplotype individuals is relatively low, but the milk yield in 305 days is relatively high. Therefore, the H001 haplotype in the two modules of the LOC112441463 gene can be used as a molecular marker for disease-resistant breeding, so that the milk production performance of dairy cows is improved.

This invention discloses the application of Ikzf3 in peripheral blood leukocytes in calculating high-energy neutron radiation dose, belonging to the field of biodetection technology. This invention focuses on the biological effects and damage mechanisms of neutron radiation, screening potential biomarkers under dose gradients. The LD50 and LD100 of neutron radiation in mice were determined to be 8 Gy and 12 Gy, respectively. The degree of damage to radiation-sensitive organs such as the spleen and intestines increased with the dose gradient. The number of lymphocytes in the blood system decreased significantly with dose, which can serve as an indicator for assessing radiation damage. Cytokines such as IL-6 and IL-10 were significantly upregulated, suggesting inflammatory and immune regulatory mechanisms. Finally, Ikzf3 was screened as a potential key gene, and its expression level changed significantly before and after irradiation, exhibiting extremely high sensitivity. This method, by detecting the expression level of Ikzf3 in peripheral blood leukocytes and substituting it into a dose-response function, can achieve rapid and objective estimation of neutron radiation dose, possessing clinical translational value.

Method for assisting determination of appropriateness of cancer treatment by intraarterial administration of immune checkpoint inhibitor, and cancer therapeutic drug for intraarterial administration SOLUTION: A method for assisting determination of appropriateness of cancer treatment by intraarterial administration of an immune checkpoint inhibitor, wherein when tumor-infiltrating lymphocytes isolated from a subject after the intraarterial administration of the immune checkpoint inhibitor are measured by flow cytometry, if the number of immune checkpoint inhibitor-bound T lymphocytes is increased after the administration of the immune checkpoint inhibitor than before the administration, the method is for assisting determination that the cancer treatment is appropriate.SELECTED DRAWING: None

The application discloses application of a biomarker combination in peripheral blood leukocytes in calculation of high-energy neutron radiation biological dose, and relates to the field of biological detection. The application focuses on neutron radiation biological effect and damage mechanism, and potential biomarkers under a dose gradient are screened. The LD50 and LD100 of mouse neutron radiation are determined as 8 Gy and 12 Gy respectively. The damage degree of radiation-sensitive organs such as spleen and intestinal tract is aggravated with the dose gradient. The number of lymphocytes in the blood system is significantly reduced with the dose, and can be used as a radiation damage evaluation index. Cytokines such as IL-6 and IL-10 are significantly up-regulated, which indicates inflammation and immune regulation mechanism. Finally, the Ms4a1, CD79a and Ikzf3 combination with extremely high sensitivity is screened. The method can realize rapid and objective estimation of the neutron radiation dose by detecting the expression amount of Ms4a1, CD79a and Ikzf3 in peripheral blood leukocytes and substituting the dose-effect function.