11results about How to "Reliable distinction" patented technology

The invention discloses a specific primer for sex identification of hippophae rhamnoides, an identification method and application of the specific primer, the specific primer for sex identification of hippophae rhamnoides comprises a Higy04 primer pair or a Higy06 primer pair, the Higy04 primer pair comprises a forward primer Higy04F: 5 '-CCCCTATAGTCACACCAACAC-3', a reverse primer Higy04R: 5 '-ATCCCATGATCATACCATAC-3', a reverse primer Higy04R: 5 '-ATCCCATGATATCATACCATAC-3', a reverse primer Higy04R: 5 '- The primer pair of the Higy06 comprises a forward primer of Higy06F: TAATCTGGTGCCTTCGATCAATT, and a reverse primer of Higy06R: TCTGTACAATTTATGCAGCACCAC, and the primer pair of the Higy06 comprises a forward primer of Higy06F: TAATCTGGTGCCTTCGATCATT, a reverse primer of Higy06R: The invention makes an important breakthrough in the development of the sex-specific molecular marker of the sea-buckthorn, has the remarkable advantages of high efficiency, strong universality, high accuracy, reliability and practicability, and can meet the urgent needs of breeding, cultivation and research of the sea-buckthorn.

The utility model provides a waterproof connector of straight head, including shell and the inner shell of being located in the shell inside, the main part is with rotatable mode and is connected to set up in the inner shell inside, the one end of cable is from the rear side and enters the inner shell inside and is connected with the terminal of being located in the main part inside, its characterized in that: the rear end outer periphery of cable is respectively equipped with waterproof plug and tail plug, the rear end of waterproof plug and the front end of tail plug axial abut, waterproof plug is located in the inside of inner shell, tail plug and the rear end fixed connection of inner shell, waterproof structure is all arranged between the inner wall of inner shell and the inner wall of shell and between waterproof plug outer wall and the inner wall of inner shell, waterproof structure is all arranged between the inner wall of inner shell and the inner wall of shell and between waterproof plug outer wall and the inner wall of inner shell, and waterproof plug is equipped with in the outer periphery of cable rear end, can effectual realization waterproof function in the inside of shell.

The invention relates to the technical field of glass manufacturing, in particular to a control system of a lump beating machine for synthetic quartz glass deposition, and the system comprises an acquisition module, a construction module, a mark generation module, a type generation module, a calculation module and an adjustment module. According to the method, geometric, thermal field and feeding rotation multi-dimensional data are collected and fused in real time, quantifiable feature vectors are constructed to accurately evaluate the working condition state, risk types such as local disturbance, thermal morphology instability and process mismatch are intelligently recognized, coupling adjustment indexes are calculated on the basis of different risks, and the working condition state is accurately evaluated. According to the method, the control dimension is controlled to be single, cooperative proportion correction and self-adaptive write-back optimization are conducted on multiple parameters such as flame power and feeding flow through driving, so that fine control over the lump growth morphology is achieved, and the problem that the morphology defect rate of a finished product is high under the complex deposition working condition due to the fact that the self-adaptive capacity is poor due to the single control dimension is effectively solved.

The present invention discloses a method for distinguishing the power of a gas turbine and a steam turbine in a single-shaft combined cycle unit. The method first calculates the power of the steam turbine and then calculates the power of the gas turbine. The method allows users to easily and relatively accurately and reliably distinguish the power of the gas turbine and the steam turbine that cannot be directly measured in a single-shaft combined cycle unit even without comprehensive data support from gas turbine manufacturers and without relying on foreign commercial software. The method is suitable for online or offline performance analysis and diagnosis of combined cycle units.

The invention relates to the technical field of photovoltaic panel detection, in particular to a photovoltaic panel defect detection method based on airborne thermal infrared images. The method comprises the following steps: acquiring multi-view thermal infrared images collected by the unmanned aerial vehicle in at least two different flight attitudes, and generating a normalized temperature difference field for eliminating environmental and geometric interferences through registration and processing; segmenting and determining a thermal anomaly region based on the statistical characteristics; internal defects and surface covering defects are automatically distinguished by calculating angle invariance indexes of the thermal behavior characteristics under multiple view angles; respectively matching an internal defect feature library or a surface covering feature library; the detection reliability is evaluated by calculating the confidence coefficient of decision, and when the confidence coefficient is insufficient, the reason is analyzed according to the infrared image resolution and the feature variation, and the flight height, the hovering duration or the aerial photography angle of the unmanned aerial vehicle is adaptively optimized to recollect data. According to the method, the problem that real faults and pseudo defects in the photovoltaic panel cannot be automatically and reliably distinguished is solved.

The invention provides a rapid identification method for muscles of rainbow trout, golden trout and coloured trout, and belongs to the technical field of biological variety identification. The method comprises the following steps: respectively preparing muscle samples of rainbow trout, golden trout and coloured trout; respectively carrying out pretreatment and GC-IMS detection on the prepared sample to obtain each volatile component and peak intensity thereof; on the basis of the peak intensity of each volatile component, principal component analysis and orthogonal partial least square discriminant analysis are respectively carried out, the peak intensity with significant difference and the corresponding volatile component are screened out, and rapid identification of muscles of rainbow trout, golden trout and coloured trout is realized. According to the method, complex pretreatment is not needed, samples can be directly detected and classified, the influence of a pretreatment reagent on the samples is reduced, rainbow trout meat, golden trout meat and coloured trout meat can be rapidly and reliably distinguished, false positive results are reduced, the detection time is only 30 minutes, and compared with PCR, molecular marker and other technologies, the detection time is greatly shortened.

The invention provides a rapid identification method for head and back muscles and tail muscles of salmon salmon, and belongs to the technical field of biological variety identification. The method comprises the following steps: respectively preparing samples of head and back muscles and tail muscles of the salmon salmon; respectively carrying out pretreatment and GC-IMS detection on the prepared sample to obtain each volatile component and peak intensity thereof; on the basis of the peak intensities of the volatile components, principal component analysis and orthogonal partial least square discriminant analysis are carried out respectively, the peak intensities with significant differences and the corresponding volatile components are screened out, and rapid identification of the head and back muscles and the tail muscles of the salmon salmon is achieved. According to the method, complex pretreatment is not needed, the samples can be directly detected and classified, the influence of pretreatment reagents on the samples is reduced, false positive results are reduced, the detection time is only 30 minutes, and the detection time is greatly shortened compared with traditional PCR and other technologies.

The application discloses a subway lighting lamp driving power supply fault detection method and system, the method comprises the following steps: acquiring voltage and current data for load correlation analysis, constructing a monitoring data matrix and determining a threshold boundary in combination with a fluctuation range set; comparing the monitoring data matrix and the threshold boundary, if the threshold boundary is exceeded, it is determined that there is an anomaly, and load correlation data and fluctuation characteristic sequences are extracted; analyzing the time sequence relationship of the load correlation data and the fluctuation characteristic sequences, and determining whether the anomaly belongs to internal failure or external interference; if the anomaly belongs to internal failure, the specific circuit position and element type of the failure are analyzed, if the anomaly belongs to external interference, a refined classification result is output; according to the specific position and element of the failure, the classification model is updated, a threshold optimization strategy is generated, the threshold boundary is adjusted, a mapping relationship between the failure and the threshold is established, and an automatic positioning result of the failure source is output. The method can realize accurate positioning of subway lighting lamp driving power supply failure.

The invention relates to a primer, a probe and a kit for distinguishing sansevieria glauca and sansevieria clavata. The nucleotide sequence of the DNA probe is as shown in SEQ ID NO.1. The invention also relates to a kit for distinguishing sansevieria glauca from sansevieria clavata. The primers comprise 1 to 2k-F and 1 to 2k-R; the nucleotide sequence of the primer 1-2k-F is as shown in SEQ ID NO. 2; the nucleotide sequence of the primer 1-2k-R is as shown in SEQ ID NO.3. The kit comprises the probe and the primer. A PCR amplification product is subjected to Sanger sequencing, sequencing results are compared, the comparison result shows that a 23 bp insertion site exists at the site of sansevieria glauca and sansevieria barbata, and the sansevieria glauca and sansevieria barbata can be distinguished, and an oligonucleotide fluorescent probe is designed according to the site, so that the detection sensitivity is improved, and the detection accuracy is improved. Therefore, the sansevieria valeriana and the sansevieria glauca can be reliably and effectively distinguished.

The utility model provides a straight head connector, which comprises a shell (1) and a main body (4) positioned in the shell (1), one end of a cable (2) extends into the shell (1) from the rear side and is connected with a terminal (3) positioned in the main body (4), and one side of the shell (1) is also provided with a locking piece. The main body (4) can drive the terminal (3) and the cable (2) to rotate in the shell while realizing axial limiting in the shell (1) through limiting fit with the inner wall of the shell (1) and the locking piece; the front end of the shell (1) is also provided with an insertion positioning part (111), and the surface of the shell is provided with an insertion color matching part (112); the front end of the shell is provided with the plugging color matching part, so that a user can simply distinguish different types of male head connectors and female head connectors in appearance, the plugging safety and the signal transmission stability are ensured, and the possibility of misplug and misplug is reduced.

The invention relates to the technical field of vehicle energy recovery, in particular to a braking energy recovery method and system based on energy conversion, and the method comprises the following steps: carrying out energy recovery state judgment based on a current battery energy storage state value to obtain a current energy recovery state; if yes, emergency degree analysis is conducted on the target running vehicle through the current braking strength and the current running speed, the current braking emergency degree is obtained, recovery braking force and mechanical braking force are obtained according to the current braking emergency degree, braking force distribution is conducted according to the recovery braking force and the mechanical braking force, and a target braking vehicle is obtained; otherwise, direct mechanical braking force is obtained, braking force distribution is conducted through the direct mechanical braking force, and the target braking vehicle is obtained. According to the invention, the adaptability and safety of the energy recovery system in different environments and driving scenes can be improved, and the energy recovery efficiency is enhanced.