163 results about "Yellow fever viruses" patented technology

The disclosed invention provides compositions and methods of treating a Flaviviridae infection, including hepatitis C virus, West Nile Virus, yellow fever virus, and a rhinovirus infection in a host, including animals, and especially humans, using a (2′R)-2′-deoxy-2′-fluoro-2′-C-methyl nucleosides, or a pharmaceutically acceptable salt or prodrug thereof.

A chimeric live, infectious, attenuated virus containing a yellow fever virus, in which the nucleotide sequence for a prM-E protein is either deleted, truncated, or mutated, so that functional prM-E protein is not expressed, and integrated into the genome of the yellow fever virus, a nucleotide sequence encoding a prM-E protein of a second, different flavivirus, so that the prM-E protein of the second flavivirus is expressed.

The present invention relates to a method of vaccinating a subject comprising delivering a chimeric yellow fever 17D strain vector expressing an envelope protein gene product of a heterologous flavivirus to the epidermal compartment or the intradermal compartment of the subject's skin. The invention encompasses vaccine compositions comprising the chimeric yellow fever viruses expressing an envelope protein gene product of a heterologous flavivirus. The compositions of the invention result in an enhanced therapeutic efficacy, e.g., enhanced protective immune response as they enhance the presentation and availability of the chimeric vaccine to the targeted compartment of the subject's skin.

The invention discloses a flavivirus human monoclonal antibody and application, which belong to the technical field of medicine. According to the flavivirus human monoclonal antibody and the application provided by the invention, three antibodies capable of protein-binding with ZIKV-E are acquired, and binding sites of the three antibodies are confirmed. The three antibodies are completely different from a reported ZIKV antibody sequence, and are three new-found antibodies. The binding constants of the three antibodies and the ZIKV-E are 39.9pM (Z5), 44.7pM (Z6) and 200pM (Z7), which show that the three human monoclonal antibodies have a higher ZIKV-E protein-binding capacity. Through competiton experiments, the binding sites of the three antibodies have competitive relationships with 2A10G6, and the phenomenon shows that the binding sites of the three antibodies are near FL, and E protein of flaviviridae is highly conserved at the FL part. The antibody provided by the invention effectively detects the infection of common flaviviridae viruses: ZIKV, dengue 1-4 type and yellow fever viruses, and has huge application values on clinic detection and fundamental research.

Methods and pharmaceutical compositions for treating viral infections, by administering certain thienopyridine derivative compounds in therapeutically effective amounts are disclosed. Methods of using the compounds and pharmaceutical compositions thereof are also disclosed. In particular, the treatment of viral infections such as caused by flavivirus is disclosed, i.e., including but not limited to, Dengue virus, West Nile virus, yellow fever virus, Japanese encephalitis virus, and tick-borne encephalitis virus.

The present invention discloses a humanized monoclonal antibody and an application thereof, belonging to the technical field of medicine. In the invention, the humanized transformation is carried outon a rat monoclonal antibody 2A10G6, the rat monoclonal antibody 2A10G6 is expressed by baculovirus, and the humanized antibody h2A10G6 is obtained. The h2A10G6 antibody of the present invention has high affinity and neutralization activity against yellow fever virus, dengue fever and West Nile virus, and can be applied to clinical treatment and prevention of yellow fever virus, dengue virus and West Nile virus.

Compounds, methods and pharmaceutical compositions for treating viral infections, by administering certain compounds in therapeutically effective amounts are disclosed. Methods for preparing the compounds and methods of using the compounds and pharmaceutical compositions thereof are also disclosed. In particular, the treatment and prophylaxis of viral infections such as caused by flavivirus is disclosed, i.e., including but not limited to, Dengue virus, West Nile virus, yellow fever virus, Japanese encephalitis virus, and tick-borne encephalitis virus.

Methods and pharmaceutical compositions for treating viral infections, by administering certain compounds in therapeutically effective amounts are disclosed. Methods of using the compounds and pharmaceutical compositions thereof are also disclosed. In particular, the treatment and prophylaxis of viral infections such as caused by flavivirus is disclosed, i.e., including but not limited to, Dengue virus, West Nile virus, yellow fever virus, Japanese encephalitis virus, and tick-borne encephalitis virus.

The present invention relates to the use of imatinib for treating viral liver diseases and in particular for viral hepatitis. The invention provides the use of imatinib for inhibiting replication, transmission or both of hepatitis viruses. The invention further relates to the use of imatinib for inhibiting replication, transmission or both of other viruses including herpes virus, poxvirus, influenza virus, para influenza virus, respiratory syncytial virus, rhinovirus, yellow fever virus, west nile virus, and encephalitis virus.

The invention encompasses nucleic acid molecules containing transcription units which encode the flavivirus M and E protein antigens. The flaviviruses include Japanese encephalitis virus, dengue, yellow fever virus and St. Louis encephalitis virus. The nucleic acids function to provide the M and E protein antigens when the nucleic acid resides in an appropriate host cell, especially when the host cell is the cell of a subject. The invention also encompasses a vaccine whose active agent is the nucleic acid. The invention further encompasses the cultured host cells when they contain within them nucleic acid molecules containing the transcription units. The invention in addition encompasses a method of immunizing a subject against flavivirus infection by administering to the subject an effective amount of a vaccine containing a nucleic acid molecule containing the transcription unit of the invention.

The invention discloses a kit for detecting a plurality of mosquito borne pathogens and a detection method thereof. The plurality of mosquito-borne infectious pathogens are detected by using multiplex polymerase chain reaction (PCR) combined with a liquid chip, and a yellow fever virus (YFV), dengue fever viruses (DV) I-IV type, epidemic encephalitis B (japanese encephalitis) virus (JEV), plasmodium (Plasmodium), (including plasmodium vivax (PV), plasmodium falciparum (PF), plasmodium malariae (PM), plasmodium ovale (PO)), a west nile virus (MNV) and a chikungunya virus (CHIKV) can be detected in parallel one time. The kit has the advantages of being large in flux, high in specificity and sensitivity, stable in result, good in repeatability, simple to operate and fast in detection speed.

The invention belongs to the field of microbial molecular detection, and particularly relates to a kit for flavivirus quick typing and virus load detection. The kit for flavivirus quick typing and virus load detection comprises specific primers and probes for flaviviruses, including specific primers and a probe for dengue virus, specific primers and a probe for Zika virus, specific primers and a probe for yellow fever virus, and specific primers and a probe for Chikungunya virus. The kit for flavivirus quick typing and virus load detection has the advantages of high detection speed and accurate detection and quantification results, can simultaneously detect 3 different flavivirus pathogens and 1 togavirus pathogen capable of causing similar clinical symptoms at one time, can detect and diagnose flavivirus-pathogen-infected suspicious cases in time, and enhances the detection accuracy of flavivirus pathogen infection.

The invention discloses a recombinant antigen protein for detecting a yellow fever virus antibody. The sequence of the recombinant protein is shown as SEQ ID NO.1; the sequence of an encoding gene of the recombinant antigen protein is shown as SEQ ID NO.2, and comprises an extension segment for encoding a flexible arm of the recombinant antigen protein; and the flexible arm can be used for eliminating masking of a peptide epitope by a fusion protein of an expression carrier, so that the expressed recombinant antigen protein is folded correctly. The invention further discloses a preparation method of the recombinant antigen protein. Moreover, a yellow fever virus kit disclosed by the invention comprises an antigen detection plate coated with the recombinant antigen protein and an ELISA (Enzyme-Linked Immunosorbent Assay) reaction liquid. The recombinant antigen protein provided by the invention has the advantages of high specificity and high affinity, does not undergo any serological cross reaction with other congenial arthropod-borne viruses, has ultrahigh affinity with the yellow fever virus antibody, and can be used for detecting the yellow fever virus antibody rapidly and accurately for diagnosing the infection condition of a yellow fever virus.

The invention provides a reagent for detecting yellow fever virus. The reagent comprises an outer primer F3, an outer primer B3, an inner primer FIP, an inner primer BIP, wherein primer gene sequences are as follows: the outer primer F3: TGGGAGAGGAGATTCACGT; the outer primer B3: TCAAGCCGCCAAATAGCC; the inner primer FIP: CCACGCCTTTCATGGTCTGAGTTTACCAGTGGCACAAAGAGG; and the inner primer BIP: AGACACCGCCTGGGATTTYAGGCAGAGCCAAACACCGTATG. The primers do not have isogeny with nucleotide sequences of other species, so that the specificity of a detection method is ensured. The method for detecting the yellow fever virus through isothermal amplification established by the primers has the advantages of simplicity and convenience in operation, high efficiency, quickness and specificity. Due to the establishment of the method, a blank of the yellow fever virus isothermal nucleic acid amplification detection method is filled, the detection on a sample can be completed by taking around one hour, and significance is provided for preventing the introduction of yellow fever virus in frontier ports.

Applicants have used microarrays, gene expression profiling, and gene silencing methods to identify and provide a plurality of ‘validated’ virus-induced cellular gene sequences (e.g., HMG20B, HRH1, NP and c-YES (src family kinases)) and pathways useful as therapeutic targets for modulation of viral-mediated cellular effects. Particular embodiments provide therapeutic compositions, and methods for modulation of viral infection, replication, maturation, progression, or other virally-related conditions or diseases, comprising inhibition of virally-induced gene sequences and gene products. Additional embodiments provide screening assays for compounds useful to modulate viral infection, replication, maturation or progression, or viral-related conditions or diseases. Further embodiments provide diagnostic and/or prognostic assays for viral infection, replication, maturation or progression. Preferably, the viruses all selected from the group consisting of retroviruses (e.g., human immunodeficiency virus (HIV), and viruses of the family Flaviviridae that includes the flaviviruses (e.g., West Nile virus (WNV), Japanese encephalitis virus (JEV), yellow fever virus (YFV) and Dengue fever virus (DEN)), and hepatitis C virus (HCV).

The invention relates to a hemorrhagic fever associated pathogen identifying gene chip; the preparation method comprises preparation of a specific primer, preparation of a pathogen specific oligonucleotide probe, preparation of an oligonucleotide chip, establishment of an RT-PCR (reverse transcription-polymerase chain reaction) system and establishment of a hybrid system and a signal detection method. The gene chip prepared by the invention can be used for simultaneously identifying 16 hemorrhagic fever associated pathogen microorganisms, including Zaire Ebola virus, Sudan Ebola virus, marburg virus, lassa virus, junin virus, Machupo virus, rift valley fever virus, Crimea-Congo hemorrhagic fever virus, plasmodium, hantaan virus, SFTS (severe fever with thrombocytopenia syndrome) virus, dengue virus, yellow fever virus, Chikungunya virus, influenza A virus and influenza B virus. The gene chip has the characteristics of being rapid and accurate, high in throughput and high in sensitivity; and a new technological means is offered for the diagnosis of hemorrhagic fever pathogen, health supervision and the control and prevention of infectious diseases.

The present invention provides rapid and accurate methods, primers, probes and kits for detecting certain flaviviruses in samples. Detectable flaviviruses include Japanese encephalitis virus serogroup members, dengue virus, St. Louis encephalitis virus, Montana myotis leukoencephalitis virus, Modoc virus, and yellow fever virus. The primers and probes of the present invention can hybridize to the region within the 3' untranslated region of the genome of the virus to be detected.

The invention discloses a fulminating-infectious-disease pathogen detecting primer pair and a kit. The primer pair comprises at least a pair of RT-LAMP primers of Ebola viruses, Lassa fever viruses, Marburg viruses, rift valley fever viruses, yellow fever viruses and Chikungunya fever viruses. By means of the primer system, the amplification reaction background is reduced, and sensitivity and specificity are quite good. The kit formed by the primer pair further comprises detecting liquid and a micro-fluidic chip; as an independent RT-PCR secondary amplification step of a detecting liquid system is omitted, detecting time is shortened; as the denaturation process and the renaturation process of nucleic acid do not exist, the polluted chance of RNA enzymes and the polluted chance of amplification nucleic acid are reduced, and the sensibility and the safety of detection are improved. By means of the constant-temperature sealed environment provided by a micro-fluidic chip system, rapid and constant-temperature amplification and automation result distinguishing of a nucleic acid extracting template are finally achieved, the requirement for test hardware is reduced, the use level of a reaction reagent is reduced, detection cost is reduced, and the result can be directly determined through color changes.

The invention relates to the technical field of biological detection, and in particular relates to a primer, a probe and a kit used for detecting dengue fever, chikungunya and yellow fever virus through a single tube by the multiplex-fluorescence PCR (Polymerase Chain Reaction). The primer and probe used for detecting the dengue fever, chikungunya and yellow fever virus through the multiplex-fluorescence PCR have nucleotide sequences as shown in SEQ ID NO: 1-9; the multiplex PCR detection kit for detecting the dengue fever, chikungunya and yellow fever virus comprises multiplex-fluorescence PCR detection mixed liquid which contains the primer and probe mentioned above. The kit, primer and probe can quickly detect the dengue fever virus, chikungunya virus and yellow fever virus, have the advantages of being simple and convenient to operate, high in sensitivity and outstanding in specificity, and can timely find out and confirm a suspect case so as to improve the monitoring level on such diseases.