Patents
Literature
PatSnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

77results about How to "Flexible length" patented technology

Universal compound bow press

This invention is a inexpensive light weight portable compound bow press that is safer and easier to use. A bow press with a greater mechanical advantage, to be used in the complete maintenance of high powered compound bows having either two piece limbs or one piece limbs. This invention consists of two extending members. Each extending member connects to the outer end of one of the bows limbs, and extend over and away from the outer ends of the bow's first and second limbs. The first end of a liner adjusting apparatus is connected to the first extending member at a central position near the outer edge of the first extending member. The second end of the adjusting apparatus is connected to the second extending member at a central position near the outer edge of the second extending member. This arrangement positions the adjusting apparatus outside and away from the compound bow, allowing for safer and easier use. The adjusting apparatus allows the archer to exert an inward force on the extending members. The extending members apply force to the outer ends of the bow's limbs, thus flexing the entire length of the limb and applying a reduced stress on the bow's riser and limbs. The mechanical advantage provided by the extending members reduces the stress on the adjusting apparatus allowing for the maintenance of high powered bows with lighter weight components. The bow's limbs are flexed inward and locked against their felix action. This way, the bow's string and cables relax and can be removed. The adjusting apparatus can then be reversed until all flex in the bow's limbs is eliminated. The bow press can be removed and the bow can then be disassembled. Assembly of the bow requires reversing this procedure.
Owner:JOHNSON KENNETH

Apparatus and method for dividing a stuffed sausage skein

An apparatus and a method for dividing a stuffed sausage skein, wherein a transport element pair is provided, including rotating opposite transport elements between which the stuffed sausage skein is conveyed in a transport direction and each of which include at least one dividing element. To be able to configure the length of the portions flexibly without mechanical adaptation, the apparatus comprises several adjacently arranged transport element pairs drivable independently of each other with corresponding dividing element pairs. The speed of the transport element pairs is adjusted such that the spacing between the points of separation corresponds to a predetermined length of the divided sausage skein.
Owner:ALBERT HANDTMANN MASCHFABRICK

LED illumination light source comprehensive measurement instrument

The invention discloses an LED illumination light source comprehensive measurement instrument. The main hardware is composed of an LED illumination light source operation table (1), a sensitization measurement table (2), a telescopic optical darkroom passageway (3) and a microcomputer main control station (4). An LED illumination light source to be measured is fastened to an LED illumination light source installation universal support in the operation table, and a polar coordinate double-shaft drive servo mechanism drives the LED illumination light source on the polar coordinate double-shaft drive servo mechanism to rotate in the horizontal direction and to pitch. The telescopic optical darkroom passageway is used for adjusting the distance between the LED illumination light source to be measured and a sensitization measurement probe. Embedded type microcomputers of all subsystems execute various types of operation, collect and transmit data and are used in cooperation with the microcomputer main control table for achievement of the measured data comprehensive processing function and the image processing function. The LED illumination light source comprehensive measurement instrument has the advantages that the LED illumination light source with any model, any wave form and any power consumption can be really measured in a relatively small space, a normal measurement parameter table is provided, and a three-dimensional analysis graphic based on tricolor light waveforms and four-dimensional dynamic video are provided as well.
Owner:吕大明

Electric motor with reduction gear mechanism

In a wiper motor including a motor body and a reduction gear apparatus, an accommodating case is integrally provided on a brush holder provided to the motor body, and this accommodating case is disposed on an outer face of a gear case so as to project from a motor yoke. A noise-preventing element including a pair of choke coils and a bidirectional varistor is accommodated in the accommodating case, and the noise-preventing element is connected between a power-feeding terminal of a connector provided on the gear case and brushes. Noises acting on a power-feeding circuit are absorbed by the noise-preventing element and noises which have leaked to the outside via an opening portion of the motor yoke are absorbed by the noise-preventing element.
Owner:MITSUBA CORP

Electric motor with reduction gear mechanism

In a wiper motor including a motor body and a reduction gear apparatus, an accommodating case is integrally provided on a brush holder provided to the motor body, and this accommodating case is disposed on an outer face of a gear case so as to project from a motor yoke. A noise-preventing element including a pair of choke coils and a bidirectional varistor is accommodated in the accommodating case, and the noise-preventing element is connected between a power-feeding terminal of a connector provided on the gear case and brushes. Noises acting on a power-feeding circuit are absorbed by the noise-preventing element and noises which have leaked to the outside via an opening portion of the motor yoke are absorbed by the noise-preventing element.
Owner:MITSUBA CORP

Method and device for testing interfacial mechanical characteristics of earthen site anchoring slurry-substrate

The invention provides a device for testing interfacial mechanical characteristics of an earthen site anchoring slurry-substrate. The device comprises a loading mechanism and a sample preparation mechanism, wherein the sample preparation mechanism comprises a sample preparation base, a plurality of side wall blades, blade lock rings, a polished round core and a threaded core; a through hole is arranged in the center of the sample preparation base; the plurality of side wall blades are arranged at the upper part of the sample preparation base, are in an arc form and are enclosed into a hollow cylinder; the blade lock rings sleeve the outer sides of the blade lock rings respectively to hold the side wall blades; and the polished round core and a threaded core can be inserted into the through hole in the sample preparation base and the samples with different hole wall roughness can be manufactured separately. The invention further provides a method for testing the interfacial mechanical characteristics of the earthen site anchoring slurry-substrate.
Owner:LANZHOU UNIVERSITY

Apparatus and method for dividing a stuffed sausage skein

An apparatus and a method for dividing a stuffed sausage skein, wherein a transport element pair is provided, including rotating opposite transport elements between which the stuffed sausage skein is conveyed in a transport direction and each of which include at least one dividing element. To be able to configure the length of the portions flexibly without mechanical adaptation, the apparatus comprises several adjacently arranged transport element pairs drivable independently of each other with corresponding dividing element pairs. The speed of the transport element pairs is adjusted such that the spacing between the points of separation corresponds to a predetermined length of the divided sausage skein.
Owner:ALBERT HANDTMANN MASCHFABRICK

Synchronous trigger device and method for electromagnetic transient data collection

InactiveCN108957199AReduce electromagnetic shockReliable Synchronous TriggeringElectrical measurement instrument detailsMeasuring interference from external sourcesCollections dataEngineering
The present invention discloses a synchronous trigger device and method for electromagnetic transient data collection. The device comprises a shielding housing, an operational amplifier module, a power module, a high-speed comparer and an optical pulse generator; the operational amplifier module, the power module, the high-speed comparer and the optical pulse generator are arranged in the shielding housing; a signal output end of the operational amplifier module is connected with a signal receiving end of the high-speed comparer; a signal output end of the high-speed comparer is connected witha signal receiving end of the optical pulse generator, and a signal output end of the optical pulse generator is configured to emit synchronous trigger signals; and the power module is connected withthe operational amplifier module and the optical pulse generator. The synchronous trigger device can be operated in a high transient electromagnetic interference environment; and the synchronous trigger device and method can achieve nanosecond reliable synchronous trigger with high sensitivity.
Owner:STATE GRID CORP OF CHINA +2

Neural network maxout layer calculation device

The invention provides maxout layer calculation device, and aims at executing maxout layer calculation according to maxout layer operation instructions. The device is characterized by comprising a maxout layer calculation module, wherein the maxout layer calculation module is connected with a storage module and comprises a register unit, a loading / storage unit, a pruning unit and a calculation unit; the register unit is used for storing a maxout layer input data addresses which are storage addresses, in the storage module, of maxout layer input data; the loading / storage unit is used for obtaining corresponding maxout layer input data from the storage module according to a maxout layer input data address corresponding to a maxout layer calculation instruction; the pruning unit is used for compressing the maxout layer input data which is preferably stored according to features on the feature dimension so as to obtain pruned data; and the calculation unit is used for carrying out corresponding calculation on the pruned data according to the maxout layer calculation instruction so as to obtain a maxout layer calculation result.
Owner:CAMBRICON TECH CO LTD

Coding and decoding method for integrity check and error correction of DNA sequence

ActiveCN112802549AFlexible lengthProteomicsGenomicsDecoding methodsCodon degeneracy
The invention discloses a coding and decoding method for DNA sequence integrity check and error correction. The coding and decoding method comprises a DNA integrity coding algorithm and a DNA integrity decoding algorithm. A coder uses a DNA integrity coding algorithm to code a DNA sequence to be subjected to integrity protection, and uses codon degeneracy to embed integrity verification information without changing corresponding amino acids, and does not introduce additional bases. After the synthesized DNA sequence is subjected to a biochemical process, a sequencing result has the possibility of introducing base insertion, deletion and replacement. A decoder can use a DNA integrity decoding algorithm to perform verification and error correction on a sequencing result. If the sequencing result of the sequence is error-free, the decoding algorithm must feed back that the sequencing result is error-free; if an error exists in the sequence sequencing result, the decoding algorithm judges that the error exists in an extremely high probability and corrects the error, and the recovered sequence capable of passing through the decoding algorithm is a decoding result; and if the error digits exceed the error digits willing to undertake by the decoders, the serious errors are prompted to be unrecoverable.
Owner:WUHAN UNIV

Multi-angle adjustable scaffold steel tube and steel tube scaffold

The invention provides a multi-angle adjustable scaffold steel tube and a steel tube scaffold. The steel tube is a cross rod or a horizontal inclined rod and further comprises lock heads, connecting pieces, socket-and-spigot substrates and connecting parts. The lock heads are flat, a long groove is formed in the middle of each lock head, and through holes are symmetrically formed in the two sides of each lock head. One end of each connecting piece is embedded into the long groove of the corresponding lock head and provided with a second through hole corresponding to the corresponding through hole, and the other end of each connecting piece is connected with the corresponding socket-and-spigot substrate. The tail ends of the socket-and-spigot substrates are connected with the connecting pieces, the head ends of the socket-and-spigot substrates comprise conical grooves, the inner portions of the conical grooves are narrower than the outer portions of the conical grooves, the upper portions of the conical grooves are narrower than the lower portions of the conical grooves, and the direction of the conical grooves is parallel to the direction of the connecting pieces. The connecting parts connect the through holes and the second through holes in a penetrating mode, the cross rod or the horizontal inclined rod and the socket-and-spigot substrates can relatively move with the connecting parts as pivots. According to the scaffold steel tube, the length and the angle can be adjusted, the angle adjusting activity range is wide, and the length is flexibly, easily and conveniently adjusted. The steel tube scaffold is high in overall stability, simple in structure, convenient to install and detach, safe and reliable.
Owner:湖南金峰金属构件有限公司

Profile ground rail for robot

The invention discloses a profile ground rail for a robot. The ground rail comprises a profile ground rail mechanism, a sliding mechanism, a lubricating mechanism and a drag chain. According to the design of the ground rail, a profile is selected as a ground rail track, a ground rail supporting seat is used for fixing and supporting the ground rail track, a linear sliding rail used for guiding isarranged on a track base in the track direction of the ground rail, a gear and a rack are arranged in parallel to the linear sliding rail, a speed reducer is installed on a sliding plate, the gear andthe rack are controlled to be in mesh transmission through the speed reducer so as to drive the sliding plate to move back and forth in the direction of the linear sliding rail, an outer travelling track is provided for a traditional multi-shaft robot, in addition, the lubricating mechanism is used for performing cleaning, lubricating and service life prolonging on the sliding mechanism, and thedrag chain arranges and generalizes cables and air pipes so as to enable the appearance of a structure to be tidy. According to the design, the profile is used for replacing an original steel part forwelding, while the moving precision of the robot is guaranteed, the track length is flexible and changeable, dirt and heat are resistant, installation, disassembly and transportation are convenient,and the cost is effectively reduced.
Owner:常青智能科技(天津)有限公司

Wire butt-joint device applicable to teaching

The invention discloses a wire butt-joint device applicable to teaching, which comprises a first butt-joint module and a second butt-joint module. The first butt-joint module comprises a first head and a first tail which are detachably connected. A first conductive column is fixed inside the first head, and the outer end of the first conductive column extends out of the first head. The second butt-joint module comprises a second head and a second tail which are detachably connected. A second conductive column is fixed inside the second tail. The first head can be connected with the second head. When the two butt-joint modules are connected, the first conductive column can be in butt joint with the second conductive column. The inner ends of the first tail and the second tail are both open,and threading holes are arranged in the outer end faces of the first tail and the second tail. The wire butt-joint device applicable to teaching in the invention can provide a flexible use mode for wiring equipment such as a power strip, so that a matching power strip can be switched between different lengths at will.
Owner:SHANGHAI JIAO TONG UNIV

Online type cutter of integrated wall surface

InactiveCN109807974AAchieve the effect of online cuttingReasonable and effective cutting structureMetal working apparatusEngineeringStructural engineering
The invention belongs to the technical field of integrated wall surfaces and in particular relates to an online type cutter of the integrated wall surface. According to the online type cutter of the integrated wall surface, by using a mode of arranging a conveying wheel, a cutting seat block body, a mounting unit, a cutter body unit, a magnetic force unit, a conductive contact unit and an intervaltriggering unit on a conveying frame, an online cutting effect during integrated wall surface conveying is achieved. The online type cutter of the integrated wall surface has the advantages that thecutting structure is reasonable and effective, the automation level of the cutting operation is high, the length needed by cutting is flexibly adjustable, the integral cutting effect is good, and theuse is safe and convenient.
Owner:RONGDE ANJIA NEW MATERIALS FUZHOU CO LTD

Construction warning sign pile

The invention discloses a construction warning sign pile. A warning lampshade top plate (1) is arranged on the top of a solar warning lamp (10). The lower portion of the warning lampshade top plate (1) is connected with a warning lampshade (2). A warning lamp switch (3) is arranged at the bottom end of the warning lampshade (2). The warning lamp switch (3) is connected with a solar warning lamp wick (10). The bottom end of the warning lampshade (2) is connected with a warning lamp base socket (4) which is inserted in a warning pile lamp socket clamping groove (5). The warning pile lamp socket clamping groove (5) is connected with a warning sign pile pillar body (7) through a fixing lutetium nail (6). The warning sign pile pillar body (7) is inserted in bottom clamping groove supporting iron (8). The bottom of the bottom clamping groove supporting iron (8) is connected with a supporting base (9). The construction warning sign pile is comprehensive in function, simple in structure, detachable, convenient to carry, firm, durable and obvious in warning effect.
Owner:STATE GRID SHANDONG ELECTRIC POWER +1

Novel adjustable wall body back ridge

The invention provides a novel adjustable wall body back ridge. The novel adjustable wall body back ridge comprises transverse levers, telescopic levers and connecting pieces; wherein the telescopic levers are the same as the transverse levers in shapes; the section sizes of the telescopic levers are smaller than those of the transverse levers; the telescopic levers are inserted into the transverse levers and are fixed through the connecting pieces; the connecting pieces comprise rotary adjusting fixing parts, and upper rotary bolts and lower rotary bolts which are fixed at the two ends of the rotary adjusting fixing parts. The novel adjustable wall body back ridge is simple in structure, is reasonable in design, and is convenient to use and operate.
Owner:TIANJIN XINFUSHENG NEW BUILDING TEMPLATE CO LTD

Novel mechanical equipment sweeper with improved structure

The invention provides a novel mechanical equipment sweeper with an improved structure. The novel mechanical equipment sweeper comprises a motor, a speed reducer, an output shaft, a coupler, a brush, a telescopic structure, connecting bolts, a connecting shaft and a bearing seat, wherein the motor is arranged at the upper part of the speed reducer; the output shaft is arranged at the right side of the speed reducer; the coupler is arranged at the right end of the output shaft; the brush is arranged outside the telescopic structure; the telescopic structure is arranged at the right side of the coupler; the connecting shaft is arranged at the right side of the telescopic structure in a connecting way by the connecting bolts; the bearing seat is arranged at the left side of the connecting shaft. According to the novel mechanical equipment sweeper, the speed reducer, the brush and the telescopic structure are arranged, so that the length can be more flexibly adjusted, transmission equipment with different widths can be conveniently installed, the application scope is enlarged, the cost is lowered, and the service life is prolonged.
Owner:天津天成昇科技有限公司

Method and application of quickly screening arsenic ion aptamers

The invention relates to a reaction system of screening arsenic ion aptamers by means of a colorimetric method for optimizing an aptamer sequence of arsenic ions and detecting arsenic ions in water. The reaction system is characterized by comprising a nucleotide sequence, a nanogold solution and a sodium chloride solution, wherein the nucleotide sequence is TTA CAG AACAACCAACGTCGCTCCGGGTACTTCTTCATCG, TTA CAGAACAACCAACCCGGGTACTTCTTCATCG, TAG GGAGAT ACCAGC and TTACAGAACAACCGGTACTTCTTCATCG. The invention also provides an application of detecting arsenic ion concentration by means of the colorimetric method. As the screening process is simple and fast, an auxiliary reagent is relatively easily obtained, and measurement can be performed by means of naked eye judgment or a spectrophotometer, so that the screening difficulty of the aptamers is greatly reduced, and immobilized application and fast detection are facilitated.
Owner:UNIV OF SHANGHAI FOR SCI & TECH

Symbol processing method and device

The invention provides a symbol processing method and device, and the method comprises the steps: enabling a plurality of obtained complex symbols to be divided into a plurality of sets, wherein eachset is corresponding to one transmitting symbol, and the sets comprise a first set corresponding to a first transmitting symbol; and mapping the first sequence and the second sequence to a first set,wherein the end position of the first sequence is the position of the intercepted cyclic prefix CP of the first transmission symbol, and the end position of the second sequence is the end position ofthe first transmission symbol. By mapping the sequence to the set, not only can the original cyclic prefix CP be expanded by utilizing the sequence with flexible length, but also flexible guard intervals with different lengths can be configured for each user by adjusting the length of the sequence.
Owner:CHENGDU HUAWEI TECH

Thermosensitive recording medium and manufacturing method thereof

There is provided a thermosensitive recording medium in which a first thermosensitive coloring layer that develops a first hue and a second thermosensitive coloring layer that develops a second hue different from the first hue, wherein the first and second thermosensitive coloring layers having the respective widths are continuously formed in stripes in a longitudinal direction of a substrate. There is also described a method of manufacturing a number of the thermosensitive recording mediums from a substrate in that, after a multiplicity of the thermosensitive coloring layers are formed by repetitively coating a plurality of water-dispersion thermosensitive inks on the substrate having an ink receptive layer thereon, the respective inks having different coloring hues, the substrate is slit into multiple thermosensitive recording mediums along a line or lines provided over any of the thermosensitive coloring layer or layers.
Owner:TOSHIBA TEC KK

An electric wire tensioning device

The invention relates to an electric stringing and tightening device which comprises a front tightening arm (3), a rear tightening arm (7), a tightening rocking handle (5), a pulley base (8), a pulley (9) of the pulley base (8), a tightening rope (10) and a tightening mechanism, wherein the front tightening arm (3) is hinged with the rear tightening arm (7) by a hinge shaft (6); the tightening rocking handle (5) and the pulley base (8) are respectively hinged with the front end of the front tightening arm (3) and the rear end of the rear tightening arm (7); and the tightening mechanism is connected with the tightening rope (10). The electric stringing and tightening device is characterized in that a wire claming but (2) is arranged at the upper part in front of the front tightening arm (3); pay-off nuts (4) are respectively arranged at the upper part and the lower part at the back of the rear tightening arm (7); and a pay-off rod (15) with hooks, which are inserted and taken out by matching with the screw hole distances of the upper and lower pay-off nuts (4), is arranged at the positions of the upper and lower pay-off nuts (4). The invention adopting the technology has the characteristics of simple structure, easiness for processing and manufacturing, small size, light weight, simpleness for operation, one-time finishing for a tightening project, high efficiency and the like.
Owner:STATE GRID HEILONGJIANG ELECTRIC POWER CO LTD HARBIN POWER SUPPLY CO +1

Random access method, terminal device and network device

The embodiment of the invention provides a random access method, a terminal device and a network device. The method comprises the following steps: the terminal device sending random access informationto the network device, wherein the random access information is used for indicating the sending times of sending the random access information to the network device by the terminal device, or the random access information is used for indicating the length of a random access response window corresponding to the random access information, and the length of the random access response window is configurable; and the terminal device detecting a random access response in the random access response window. According to the random access method, the terminal device and the network device provided bythe embodiment of the invention, the length of the random access response window can be flexibly changed along with the sending times of the random access information so as to meet the requirements ofdifferent unlicensed spectrum systems.
Owner:HUAWEI TECH CO LTD

Combined component supporting tooling system and construction method thereof

The invention discloses a combined component supporting tooling system and a construction method thereof. The supporting tooling system comprises a plurality of single portal framed bents which are sequentially spliced, wherein each single portal framed bent comprises a framework-type structure formed by transverse supporting rods and vertical supporting rods, and also comprises servo electric cylinders arranged at the upper ends of the vertical supporting rods, rotating pad plates arranged at the tops of the servo electric cylinders, and support seats arranged at the bottoms of the vertical supporting rods; and the adjacent single portal framed bents are fixedly connected through the horizontal rods and combined tension connectors arranged at two ends of the horizontal rods. The combinedcomponent supporting tooling system and the construction method thereof have the advantages that the installation is convenient, the arrangement is flexible, and the control is precise. The fast, convenient, safe, efficient, precise and stable installation of prefabricated components on a construction site can be realized.
Owner:SHANGHAI CONSTRUCTION GROUP

Bending tool

InactiveCN104826902AGood for rotational moldingGuaranteed circumference sizeMechanical engineeringVariable size
The invention relates to a bending tool. The bending tool comprises a fixed mold fixed to a working platform, a fixing shaft is fixedly installed at the upper portion of the fixed mold and is sleeved with a detachable sleeve, the sleeve is connected with a handle, a movable mold is installed at the position, close to the sleeve, of the handle, and a gap is reserved between the fixed mold and the movable mold. The fixed mold and the movable mold are in sliding wheel shapes, three fourth of the circumference of the fixed mold extends out of the working platform, the movable mold is connected to the handle through a small fixing shaft, and the handle is a long-strip-shaped round pipe. The diameter of the fixed mold is larger than the diameter of the movable mold. The bending tool is simple in structure, convenient to operate, low in cost and flexible and variable in length and angle, and is particularly suitable for machining occasions in variable sizes.
Owner:临沂强骏车辆有限公司

Large robot ground rail equipment

The invention belongs to the field of ground rail equipment, and particularly discloses large robot ground rail equipment. The ground rail equipment comprises a ground rail mechanism, a sliding mechanism and a control system. The ground rail mechanism is arranged on the ground and comprises a plurality of main body frames, and the ends of the main body frames are connected in series to form the ground rail mechanism. Each main body frame is provided with ground rail supporting seats and a supporting profile, wherein the supporting profile comprises a supporting frame plate and supporting ribs,connecting seats are fixedly mounted at the two ends of the supporting frame plate, and the supporting ribs are fixedly mounted on the inner side of the supporting frame plate and are in an M shape.The ground rail supporting seats are arranged along the ground at intervals, and the ends of the ground rail supporting seats are fixedly connected with the connecting seats through connecting bolts.The sliding mechanism is arranged on the upper portion of the ground rail mechanism and comprises a linear guide rail, a rack, a sliding block, a driving tray and a driving structure. The ground railequipment can be matched with robots of different specifications and different brands and can be more widely applied to automatic production in different fields, and the length is more flexible and changeable while the motion precision of the robots is guaranteed.
Owner:SHANGHAI WELL IDEAL IND AUTOMATION CO LTD

Extension socket

An extension socket, whose length can be selected, comprises an extension socket pedestal, a spiral steel bar, a spiral steel bar shell with a small hole, a button and an electric wire. A needed wire is set. Then the button is pressed down so as to clamp the wire, and then the length of the wire can be flexibly selected. The button is pressed down again, then the clamped wire is along a positive steel-bar elastic force direction, and then the wire is withdrawn and is entered into the spiral steel bar shell with the small hole. By using the extension socket of the invention, the length of the wire can be conveniently selected, usage is convenient and an effect is good.
Owner:马骏

Ceramic filter with double-blind-groove capacitive coupling structure

InactiveCN112038735ACapacitive coupling implementationFlexible lengthWaveguide type devicesMetal coatingCapacitive coupling
The invention discloses a ceramic filter with a double-blind-groove capacitive coupling structure. The ceramic filter comprises a filter body, tuning holes, a coupling groove, and the capacitive coupling structure composed of an upper blind groove and a lower blind groove, wherein the outer surface of the filter body is provided with a conductive metal coating; the tuning holes are formed in the upper surface of the body; the tuning holes are blind holes; the coupling groove is a rectangular through groove; and the capacitive coupling structure is composed of the upper blind groove and the lower blind groove which are the same in length, width and height, and is located between the two tuning holes. According to the invention, the capacitive coupling structure composed of the upper blind groove and the lower blind groove are arranged between the two tuning holes, and a coupling amount can be changed by adjusting the length and the height of the blind grooves, so capacitive coupling ofthe ceramic filter is realized; the height of one single blind groove is smaller than half of the height of the filter, so blind slot height limitation does not exist; the lengths of the blind groovesare flexible and adjustable, so the debugging difficulty of capacitive coupling of the ceramic filter is effectively reduced, and the debugging precision of capacitive coupling is improved; and the ceramic filter has the characteristics of simple structure, convenience in design, easiness in production and preparation and the like.
Owner:HUAZHONG UNIV OF SCI & TECH

Portable DC test discharge rod

The invention discloses a portable DC test discharge rod, relates to a discharge device used in an electric property testing process and is used for solving a problem of susceptibility of length change of a prior electricity testing rod due to external interference. The portable DC test discharge rod includes a telescopic insulation body comprising a bottom sleeve, a middle sleeve and an upper sleeve. A spiral screw rod having a length equal to that of the bottom sleeve is arranged in the bottom sleeve. A hollow connection rod having a length equal to that of the middle sleeve is arranged in the middle sleeve. A hollow screw rod having a length equal to that of the upper sleeve is arranged in the upper sleeve. The spiral screw rod is provided with male threads. The hollow screw rod is provided with female threads. The inner surface and the outer surface of the hollow connection rod are both provided with threads. The threads on the inner surface of the hollow connection rod cooperate with the male threads of the spiral screw rods. The male threads of the hollow connection rod cooperate with the female threads of the hollow screw rod. The portable DC test discharge rod is applied toDC voltage withstanding tests and releases electric charges accumulated on a test sample.
Owner:STATE GRID SHANDONG ELECTRIC POWER +2

Unmanned aerial vehicle flight controller

The invention discloses an unmanned aerial vehicle flight controller, which belongs to the field of unmanned aerial vehicles. The unmanned aerial vehicle flight controller comprises a main control module, an IMU module, a communication module and a positioning module, wherein all the modules are connected through waterproof cables, the lengths of the waterproof cables are adjustable, and thereforeall the modules can be placed in different directions of the unmanned aerial vehicle, and the positions of all the modules are flexible and adjustable. On the other hand, interfaces are simplified, redundant interfaces of a traditional unmanned aerial vehicle flight controller are reduced to one micro rectangular connector interface, and after all modules and peripherals are connected, the waterproof capability of the unmanned aerial vehicle flight controller is greatly enhanced and the operation difficulty of a user is reduced due to the fact that no exposed interface exists. According to the unmanned aerial vehicle flight controller, the core components are distributed in different modules, the modules can be placed at different parts of the unmanned aerial vehicle according to requirements so as to adapt to complex flight requirements, the modules are convenient to replace, and the service life of flight control is prolonged.
Owner:NORTHWESTERN POLYTECHNICAL UNIV

Power strip suitable for simulation teaching

The invention discloses a power strip suitable for simulation teaching, and the power strip comprises a connection unit which comprises a first wire, wherein the two ends of the first wire are respectively connected with a first butt joint and a second butt joint; a main body unit which comprises a socket main body and a second wire connected with the socket main body, wherein the tail end of thesecond wire is connected with the first butt joint; a power connection unit which comprises a third electric wire, wherein two ends of the third electric wire are respectively connected with a plug and a second butt joint. According to the invention, the electric wire of the power strip suitable for simulation teaching can be flexibly used and the length of the electric wire can be adjusted flexibly. A user can increase or decrease the length of the power strip wire according to the needs of the user, and the wiring between the units is convenient, safe and reliable. The connection of two wires can be completed directly through butt joint operation.
Owner:SHANGHAI JIAO TONG UNIV