Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

44results about How to "Reduce the difficulty of screening" patented technology

Preparation method of industrial hemp full stalk pulp

The invention provides a preparation method of industrial hemp full stalk pulp, comprising the following steps of: cutting air-dried hemp stalk into small sections, and retting to remove a part of pectin and non-fiber impurities; charging into a digester after dehydrating, digesting hemp stalk to obtain finished pulp by a sulfate method or a caustic soda-anthraquinone method; washing the finished pulp and beating, wherein the beating concentration is 1%-6%, the beating degree is less than or equal to 40oSR, and the wet weight of the fiber is within the range of 4.0g-10.0g; and screening, purifying, dehydrating, washing, and spirally extruding and concentrating to obtain the true color pulp of the industrial hemp full stalk. The method can be used for preparing the pulp by directly using the industrial hemp full stalk, so that the pulp is directly prepared from the hemp full stalk, and the ecological environment can be importantly improved; therefore, the preparation method is good in application prospect.
Owner:YUNNAN JUHENG TECH

Non-burst ceramic preparation device and method

The invention discloses a non-burst ceramic preparation device and method. A conveying line is rotatably connected to the middle part of the inner wall of a supporting frame, a clamping and cleaning mechanism is connected to the edge part of the back surface of the supporting frame, an electric sliding rail is connected to the edge part of the back surface of the supporting frame, and a sliding block is slidably connected to the middle part of the top end of the electric sliding rail; and vertical electric telescopic rods are symmetrically welded to the two sides of the top end of the slidingblock, and a fixing plate is welded to the middle parts of the top ends of the vertical electric telescopic rods. Through the clamping and cleaning mechanism, clamping and cleaning for ceramic can befacilitated, so that the clamping and cleaning difficulty for the ceramic is lowered, and the time needed for cleaning by manually overturning the ceramic in the prior art is shortened; and therefore,the labor cost is saved, the cleaning difficulty for the ceramic is lowered, the efficiency of ceramic production is improved, then later baking for the ceramic is facilitated, the difficulty of later baking for the ceramic is lowered, and meanwhile the ceramic baked in the later period is neater and more attractive.
Owner:福建省德化县宝艺陶瓷有限公司

High throughput DNA multi-site precise base mutation method

The invention discloses a high throughput DNA multi-site precise base mutation method. Based on overlap-extension PCR high throughput, mutation is efficiently introduced into multiple sites of a target gene segment; the used primer is not a degenerate primer and is a mutant primer containing a precisely designed target mutant sequence; the length of the mutant sites is not only a single amino acidand can be continuous 1 to 5 amino acids; the primer is not synthesized through single DNA chains and is massively synthesized in an integrated chip by an oligonucleotide synthesizer; the magnitude of primer species can reach 10<4> to 10<5> species / batch; and by adjusting the reaction conditions, the mutation frequency can be controlled to a certain degree. The provided mutation database foundation method can obtain a great amount of effective mutants; the database foundation mutant positive rate (non-synonymous amino acid mutation) can reach 80%; after subsequent high throughput screening, the established mutant library can be used as a powerful tool for obtaining ideal proteins and nucleic acid modifiers.
Owner:PEKING UNIV

Sandstone screening machine for transportation construction

The invention discloses a sandstone screening machine for transportation construction. The sandstone screening machine comprises a rack, wherein a feeding barrel is arranged on the left side of the rack; a lifting assembly is arranged on the left side of an inner cavity of the rack; a guiding assembly communicates with the clearance between the lower end of the feeding barrel and the left side wall of the lifting assembly; a stirring assembly is arranged on the right side of the inner cavity; a square tube communicates with the clearance between the upper ends of the stirring assembly and thelifting assembly; a screening assembly is connected with the right side wall of the inner cavity of the rack; a discharging assembly is arranged below the screening assembly; and a first transmissionassembly is connected with the upper part of the rack. The sandstone screening machine is reasonable in structural design; through the sandstone screening machine, a sandstone material can be screenedtwice, and then sandstone particles which meet specifications can be obtained; the arrangement of power equipment can be eliminated, and then the energy consumption cost can be reduced; and the sandstone material can be subjected to pre-dehydrating treatment, the load of subsequent equipment can be reduced, and then the sandstone screening difficulty can be reduced.
Owner:宿迁市高速铁路建设发展有限公司

Sandstone separator for construction machinery

The invention discloses a sandstone separator for construction machinery, and belongs to the technical field of sandstone separation. The sandstone separator comprises a box body, a liquid spraying mechanism is arranged on one side of the top of the box body, a screening mechanism is arranged in an inner cavity of the box body, a transmission mechanism is attached to one side of the screening mechanism, a storage mechanism is movably connected to the position, corresponding to the screening mechanism, of the other side of the inner cavity of the box body; discharging holes are formed between the box body and the screening mechanism and between the box body and the storage mechanism; a discharging mechanism is arranged at the bottom of the inner cavity of the box body; and a feeding mechanism is arranged at the top of the box body. According to the sandstone separator, when a screen plate vibrates through reciprocating extrusion of polarization blocks, the screen plate vibrates to enable silt in mortar to fall into a bottom sand box, and at the moment, the screened-out sandstone can move through the inclined screen plate to fall into the discharging holes on one side and a stone boxon one side, so that the sandstone can be quickly separated, and then the screening difficulty can be reduced; and the screening efficiency is remarkably improved through reciprocating vibration, andthe discharging difficulty is effectively reduced.
Owner:浙江绩丰机械有限公司

Method and application of quickly screening arsenic ion aptamers

The invention relates to a reaction system of screening arsenic ion aptamers by means of a colorimetric method for optimizing an aptamer sequence of arsenic ions and detecting arsenic ions in water. The reaction system is characterized by comprising a nucleotide sequence, a nanogold solution and a sodium chloride solution, wherein the nucleotide sequence is TTA CAG AACAACCAACGTCGCTCCGGGTACTTCTTCATCG, TTA CAGAACAACCAACCCGGGTACTTCTTCATCG, TAG GGAGAT ACCAGC and TTACAGAACAACCGGTACTTCTTCATCG. The invention also provides an application of detecting arsenic ion concentration by means of the colorimetric method. As the screening process is simple and fast, an auxiliary reagent is relatively easily obtained, and measurement can be performed by means of naked eye judgment or a spectrophotometer, so that the screening difficulty of the aptamers is greatly reduced, and immobilized application and fast detection are facilitated.
Owner:UNIV OF SHANGHAI FOR SCI & TECH

Application of coding multiple small fragment RNA vector in gene interference and gene activation

The invention provides an application method of a vector capable of simultaneously coding multiple short-hairpin RNAs (shRNAs) for activating the same or different genes, or for simultaneously performing gene interference or gene activation to different genes. The method comprises the following steps of: (1) determining a regulation scheme of a target gene, designing the number of the shRNA corresponding to each gene, and selecting the target site; (2) synthesizing DNA template for coding shRNAs, and constructing a multiple shRNAs expression vector; and (3) applying the constructed multiple shRNAs expression vector to am experimental subject with a proper way as required. The invention provides a convenient and effective application scheme for applying the specific regulation mechanism of shRNA to scientific research and clinics.
Owner:WUCHANG SHIPYARD

Energy storage system and method for storing energy by using cascaded battery packs

The invention relates to an energy storage system and a method for storing energy by using cascaded battery packs and belongs to the field of energy. The flexibility of second cascaded utilization canbe improved, the design flexibility of the energy storage system is improved, and different needs of different customers can be satisfied. The energy storage system includes at least two series branches which comprise directly used cascaded battery packs and voltage conversion modules, the directly used cascaded battery packs and voltage conversion modules are connected in series, and the at least two series branches are connected in parallel. The voltage conversion modules are used for converting the voltage of the directly used cascaded battery pack connected to the voltage conversion modules in series into preset voltage, and the preset voltage of all the series branches is the same.
Owner:BYD CO LTD

A method of site-directed insertion to h11 locus in pigs by using site-directed cutting system

InactiveUS20180105834A1Simple and fast and efficient gene insertionLow efficiencyStable introduction of DNANucleic acid vectorGenomeBiology
The present invention provides a method of site-directed insertion to H11 locus in pigs by using site-directed cutting system, includes the following steps: 1) identify the targeted sequence targeted by the targeted cutting system in the targeted genome sequence of pigs; 2) design and construct the targeting sequence of the corresponding cutting system according to the targeted site; 3) construction of targeting vector; 4) transfect cells, identify the efficiency of fixed-point insertion by PCR amplification. The invention is dependent on the site-directed cutting system of H11 locus in pigs, to insert the target gene into the target site, in order to solve the problems such as low efficiency of traditional shooting technique, inconvenience design of PCR detection primer, harder to detect. The invention provides a method of site-directed insertion which can stably express the foreign gene at the H11 locus, to build an efficient platform for the production of transgenic pigs.
Owner:INST OF ANIMAL SCI OF CHINESE ACAD OF AGRI SCI

Processing method for high-strength environment-friendly concrete

The invention discloses a processing method for high-strength environment-friendly concrete. The environment-friendly concrete consists of the following components in parts by weight: 100-200 parts ofcement, 40-130 parts of water, 23.8-59 parts of quartz sand, 46.2-82.4 parts of broken stones, 1-2 parts of a water reducer, 10-30 parts of mica powder, 5-30 parts of a waterproof agent, 0.5-2 part of a flame retardant, 40-80 parts of cinerite, 10-30 parts of waste PPR powder, 245-490 parts of sand, 60-120 parts of an adhesive and 60-80 parts of industrial waste slag powder. Waste PPR powder andindustrial waste residue powder, which are added into concrete, are poured into a stirrer to stir, so that use amount of cement is reduced, and production cost is reduced; mica powder, quartz sand andcinerite are added, so that hardness, pressure resistance and water seepage resistance of concrete can be improved; and meanwhile, a heat conduction rate of the concrete is reduced, so that the concrete has highest hardness, highest compressive strength, low heat conduction rate and strong water seepage resistance; and meanwhile, production cost is reduced, waste PPR powder and industrial waste residue powder are recycled, so that the environment-friendly purpose is achieved.
Owner:舟山恒尊预拌混凝土有限公司

Screening method for active substances of plants

The invention provides a screening method for active substances of plants. The screening method comprises the following steps: (a) separating and purifying tubulins from pig brains; (b) performing fluorescence labeling on the tubulins to obtain fluorescence labeled tubulins; (c) mixing the tubulins, the fluorescence labeled tubulins and substances to be screened and performing a polymerization reaction; (d) performing microscopic observation on a polymerization product to obtain a microscopic picture; quantifying the quantity, length and roughness of the tubulins in the microscopic picture through applying computer software; carrying out conversion analysis on data and determining the activity of the substances to be screened according to a result. According to the screening method, the tubulins of the pig brains are subjected to the fluorescence labeling under an in-vitro condition, and the density, length frequency distribution and the like of the tubulins after the polymerization reaction are quantified by applying the computer software and are used as evaluation indexes for measuring factors influencing nucleation, elongation or reduction of the tubulins, so that the influences on the polymerization of the tubulins by the active substances of the plants are judged and a method model is provided for high-throughput screening researches for digging the active substances of the plants.
Owner:SOUTHWEST UNIVERSITY

Aggregated rock screening device for industrial building and use method thereof

The invention discloses an aggregated rock screening device for an industrial building. The aggregated rock screening device comprises a feeding table, a first supporting frame, a driven transmissionwheel, a driving grinding roll, universal wheels, a discharging plate, a second supporting frame, a driven adjusting gear, a gear motor, a screening motor, an annular steel ring, a screening rod, a screening barrel, a driving motor, a screening mesh, a conveying belt, a feeding baffle, a driving transmission wheel, a driving adjusting gear, a fixed rod, a driven grinding roll, a bevel gear, a transmission motor, a driving belt wheel, a driven belt wheel, a discharging funnel, a fixed frame, a discharging baffle, a driving gear and a driven driving gear. A feeding table is fixed to the top of the first supporting frame. According to the aggregated rock screening device, aggregated rock conveyed up by the conveying belt is primarily screened through the screening mesh, and the aggregated rock moves towards the next processing position under the action of the gravity of itself in the screening process; the structure is simple, and operation is convenient; and the time consumed by manual moving of the aggregated rock is saved, and the work efficiency is improved.
Owner:安徽正兴和光电科技有限公司

Method, device and equipment for screening upper gastrointestinal endoscopic images, and storage medium

The embodiment of the invention discloses a method, a device and equipment for screening an upper gastrointestinal endoscopic image, and a storage medium. The method comprises the following steps: inputting each endoscopic image in an endoscopic image set of an upper digestive tract into a pre-trained part classification model to obtain a part category of each endoscopic image; inputting all the endoscopic images of each part into a pre-trained target detection model to obtain a target image set of each part; classifying each target image map in the target image map set according to a pre-trained classification model to obtain a classification result of each target image map; and screening the endoscopic images in the target image set of each part according to the classification result to obtain the screened endoscopic images. Based on the artificial intelligence technology, the screening difficulty of the endoscope images is reduced, the screening time of the endoscope images is saved, and the quality and accuracy of subsequently generated endoscope reports are improved.
Owner:WUHAN ENDOANGEL MEDICAL TECH CO LTD

Breeding method of specified-pathogen-free experimental pigs and application of breeding method of specified-pathogen-free experimental pigs

The invention provides a breeding method of specified-pathogen-free experimental pigs and application of the breeding method of the specified-pathogen-free experimental pigs, and relates to the technical field of breeding of experimental animals. The provided breeding method of the specified-pathogen-free experimental pigs comprises the following steps: making pathogen-free pregnant sows have natural deliveries in a sterile environment, transferring delivered piglets into a barrier environment, and after feeding is conducted for at most 14 days, conducting weaning to obtain the specified-pathogen-free experimental pigs, wherein feeding comprises intestinal probiotic feeding, artificial milk feeding, and solid feed ingestion induction. By means of the provided breeding method of the specified-pathogen-free experimental pigs, not only are the problems of low quality and long time of experimental pigs obtained through an ordinary method solved, but also the delivery technology and obtaining cost is controlled in a low range, and the fact that the high-quality specified-pathogen-free experimental pigs are obtained from breeding can be guaranteed at the same time.
Owner:TECON BIOLOGY CO LTD +1

Task scheduling method, based on virtual partitioning, for reconfigurable system

The invention discloses a task scheduling method, based on virtual partitioning, for a reconfigurable system. According to the method, task significance parameters are defined according to the reappearance frequency of tasks, virtual partitioning is carried out on reconfigurable resources, and partitioning management is carried out on the tasks at different significance levels. When task significance values are increased, some tasks are transferred from one partition to another partition. When the tasks are completed, the configuration of the tasks is retained as far as possible instead of being removed from the reconfigurable resources; when the same tasks reappear, computation can be directly carried out, so that the configuration frequency is decreased and the reconfiguration expenditure is lowered. Even though the probability of reuse of the tasks can be increased by retaining the configuration of the completed tasks on the reconfigurable resources, idle resources of the reconfigurable resources can be reduced at the same time. When new tasks arrive, if the idle resources are not enough, the sizes of the partitions are modified according to certain conditions; if the idle resources are still not enough, one or more retained tasks are selected from the partition where the tasks at the lowest significance level are placed, and the retained tasks are replaced by the new tasks.
Owner:江苏中服焦点跨境贸易服务有限公司

Urban waste classified recovery device for municipal engineering

The invention discloses an urban waste classified recovery device for municipal engineering. The urban waste classified recovery device comprises a first box body and a second box body, wherein a feeding opening is formed in the top of the first box body, and a filtering plate is arranged below the feeding opening; a material receiving box is arranged at the bottom of the first box body, a first supporting plate is arranged on the inner wall of the first box body, and a first driving motor used for driving the first supporting plate to be matched is arranged on the side wall of the first box body; and a scraper matched with the filtering plate is arranged in the first box body, a first opening is formed in the side wall of the first box body, and clear water is contained in the second boxbody. Filtered objects are screened under the buoyancy effect of the clear water, so that disposable chopsticks and plastic bags float on the water surface, bones, metal and other garbage are precipitated at the bottom of the second box body, therefore the disposable chopsticks and the plastic bags are directly collected, the garbage screening difficulty is reduced, and garbage screening is more convenient.
Owner:陈波波

Tea processing device

The invention discloses a tea processing device and in particular relates to the technical field of tea producing machines. The tea processing device comprises a tea screening mechanism and a tea pillow manufacturing mechanism, wherein the tea screening mechanism comprises a box body, a tea storage chamber, a screening device and a collecting box are arranged in the box body, and a feeding hole and a putting hole are formed in the tea storage chamber; the screening device is fixed on the tea storage chamber, the screening device comprises a fixed plate and a screening plate, the fixed plate isfixed on the tea storage chamber, a filtration pipeline is arranged on the fixed plate, sieve pores are formed in the screening plate, a spacing ring is arranged at the upper end of the filtration pipeline, and one end of the filtration pipeline is connected with the tea pillow manufacturing mechanism; and a vibrating mechanism is also arranged on the screening plate, the vibrating mechanism comprises a motor, a cam is arranged at the output end of the motor, the collecting box is arranged at the bottom of the box body, and the collecting box is arranged right below the lower end of the screening device. By adopting the technical scheme of the invention, the problems that screening is difficult, the working efficiency is low, and tea stems are useless when the tea stems are manually removed are solved, and the tea processing device disclosed by the invention can be used for screening tea leaves and the tea stems.
Owner:务川自治县馨长香茶有限公司

Corn threshing device for livestock feed production

PendingCN113068519AEasy to peelAvoid feeding operationsThreshersAgricultural scienceCrop livestock
The invention discloses a corn threshing device for livestock feed production. The corn threshing device comprises a threshing barrel, a feeding hopper is fixedly installed on the inner wall of the top of the threshing barrel, a clamping plate is connected to the inner wall of the bottom of the feeding hopper in an attached mode, a moving rod is fixedly connected to the right side of the clamping plate, a sliding column is fixedly installed on the outer wall of the moving rod, and a crankshaft is slidably connected with the outer wall of the sliding column. According to the corn threshing device for livestock feed production, firstly, corn is poured into the feeding hopper, the corn enters the threshing barrel through the component of the clamping plate, meanwhile, a main motor drives a main shaft rod and a main threshing barrel to rotate through a movable shaft, the main shaft rod drives a secondary shaft rod through a transverse rotating belt, then a secondary threshing barrel rolls, and the corn is extruded between the rolling main threshing barrel and the rolling secondary threshing barrel, so that threshing treatment of the corn is facilitated, manual feeding operation of a single corn cob is avoided, manpower waste is reduced, the workload of a user is reduced, and the corn threshing device is suitable for production and processing of a small amount of feed.
Owner:龙中飞

Method for screening active ingredients of traditional Chinese medicine

The invention is suitable for the field of traditional Chinese medicine and provides a method for screening active ingredients of traditional Chinese medicine. The method comprises the following steps: preparing a chromatographic column; preparing Danhong sample liquid; and screening through the chromatographic column. The method successfully screens out the active ingredients for cardiovascular and cerebrovascular diseases in Danhong injection, the screening efficiency is improved, and meanwhile the safety of the Danhong injection is greatly improved.
Owner:RESEARCH INSTITUTE OF TSINGHUA UNIVERSITY IN SHENZHEN

Area color matching method and device, electronic device, and computer-readable storage medium

The present disclosure relates to an area color matching method and apparatus, an electronic device, and a computer-readable storage medium. A region color matching method includes determining a target region within a real scene; Acquiring an actual color of a region around the target region; Determining a target color of the target area according to the actual color based on a preset color matching principle. As that target color of the target area is determine according to the actual color of the area around the target area in the embodiment of the present disclosure, the target color can bematched with the surrounding color, the color matching effect can be improve, and the experience of using the augmented reality device can be realized.
Owner:BEIJING XIAOMI MOBILE SOFTWARE CO LTD

Method for displaying, searching and linking geographical information and product on map

InactiveCN108572982ADisplay balanceHumanized searchSpecial data processing applicationsAdministrative divisionKeyword search
The invention discloses a method for displaying, searching and linking geographical information or a product on an administrative division map. The method comprises the steps that according to displayrequirements of information or product, an appropriate administrative division map geographic level is selected, the information or product of each area is selected, a name and picture of the information or product and a link interface linking detailed information of the information or product are marked on the administrative division map of the area, and a plurality of key word search links areprovided for each piece of information or product. The method for displaying, searching and linking the geographical information or the product on the administrative division map has the advantages that the information or product can be comprehensively displayed, so that the display chances of all information or products are more equal, the threshold of an industry is effectively lowered, the product display effect is good, the product screening difficulty is smaller, a user can pre-consult the displayed products, more choices can be provided for the user, the user can click and consult information according to his or her interest, the searching and linking method is more user-friendless, and the practical performance is higher.
Owner:贺树青

Preparation method of biological organic fertilizer with ecological chitin

The invention belongs to the technical field of fertilizers prepared from wastes or residues, and particularly relates to a preparation method of a biological organic fertilizer with ecological chitin, which comprises the following steps: airing insect or crustacean shells, crushing into powder, and uniformly mixing organic wastes, the powder and biological humic acid to obtain a base material; placing the base material in a feeding cavity of the feeding device for feeding earthworms; scraping a wormcast mixture on the upper layer of the base material into a collecting cavity layer by layer through a scraping plate, and repelling meanwhile earthworms through an illuminating lamp; sieving the excrement mixture, drying the separated wormcast to remove moisture, and preparing the required organic fertilizer; By means of the mode, the excrement mixture is automatically collected, the excrement mixture does not need to be manually harvested in a time-consuming and labor-consuming mode, the labor burden of workers is greatly relieved, meanwhile, the content of base materials in the collected excrement mixture is reduced, and the purity of wormcast in the excrement mixture is improved; and the follow-up wormcast screening difficulty is greatly reduced.
Owner:山东晨阳生物科技有限公司

Sand and gravel separator for construction machinery

The invention discloses a sand and gravel separator for construction machinery, which belongs to the technical field of sand and gravel separation. One side of the sieve mechanism is bonded with a transmission mechanism, and the other side of the box cavity is movably connected with a storage mechanism at the corresponding position of the sieve mechanism, and a discharge hole is opened between the box body, the sieve mechanism and the storage mechanism. A discharging mechanism is provided at the bottom of the inner cavity of the box, and a feeding mechanism is provided at the top of the box. In the present invention, when the sieve plate vibrates through the reciprocating extrusion of the polarizing block, the silt in the mortar will fall into the bottom sandbox through the vibration of the sieve plate. The side discharge hole and the stone box on one side can quickly separate the sand and gravel, thereby reducing the difficulty of screening, and the reciprocating vibration can significantly improve the screening efficiency and effectively reduce the difficulty of discharging.
Owner:浙江绩丰机械有限公司

A high-throughput DNA multi-site precise base mutation method

The invention discloses a high-throughput DNA multi-site precise base mutation method. The method provided by the present invention is a method for efficiently introducing mutations at multiple sites of target gene fragments based on overlap extension PCR high-throughput; the primers used are not degenerate primers, but mutation primers that accurately design the target mutation sequence; the length of the mutation site is not Limited to a single amino acid, it can be designed as 1-5 consecutive amino acids; primers are not synthesized separately, but are synthesized in batches by an oligonucleotide synthesizer on an integrated chip, and the number of primers can reach 10 4 -10 5 Type / batch; the mutation method of the present invention can control the mutation frequency to a certain extent by adjusting the reaction conditions. The mutation library construction method of the present invention can obtain a relatively high proportion of effective mutants, and the positive rate of mutants (non-synonymous amino acid mutation) can reach 80%; the mutant library constructed by the present invention undergoes subsequent high-throughput screening It becomes a powerful tool for obtaining ideal protein and nucleic acid transformation bodies.
Owner:PEKING UNIV

A new energy vehicle, power supply control method and storage medium

ActiveCN111216593BEliminate loss and wasteAchieving Adaptive Power SupplyCharging stationsElectric vehicle charging technologyElectrical batteryNew energy
A new energy vehicle, a power supply control method and a storage medium, belonging to the technical field of new energy vehicles. It includes a central control module, a power management module and a battery array. The power management module is connected to the central control module. It is characterized in that: a battery adaptation module and a voltage acquisition module corresponding to the battery modules in the battery array are provided, and the battery adaptation module and The voltage collection module is connected to the power management module; a power collection module and a temperature collection module are provided, and the output terminals of the power collection module and the temperature collection module are connected to the power management module; a temperature regulation module connected to the battery array is also provided, The power management module is bidirectionally connected with the temperature regulation module to regulate the temperature of the battery array. In this application, the idea of ​​equalizing the battery in series to control battery voltage or capacity is abandoned, eliminating the waste of capacity energy and power loss caused by equalization, and realizing adaptive power supply for new energy vehicles.
Owner:张凯

Application of flavonoid compound to preparation of beta-lactamase inhibitor

The invention provides application of a flavonoid compound to preparation of a serine beta-lactamase inhibitor. Specifically, the flavonoid compound is any one or a combination of more of quercetin, fisetin, luteolin, 3 ', 4', 7-trihydroxyflavone, apigenin, kaempferol and dihydroquercetin, and particularly discloses application of the flavonoid compound in preparation of a D-serine beta-lactamase OXA-48 inhibitor. The flavonoid compound disclosed by the invention is combined with a beta-lactam drug to resist drug-resistant bacteria generating OXA-48.
Owner:MICROBIOLOGY INST OF SHAANXI

Screening system and screening method for wet powder-containing lump ore

The invention discloses a screening system and screening method for wet powder-containing lump ore, and belongs to the field of lump ore screening. The screening system for wet powder-containing lumpore comprises a feeder, a vibrating screen and a flow dividing mechanism, wherein the input end of the vibrating screen is arranged below a discharge port of the feeder, the flow dividing mechanism comprises an elastic component and a flow dividing component, the elastic component is installed at the input end of the vibrating screen, and the flow dividing component is supported between the inputend of the vibrating screen and a discharge port of the feeder through the elastic component so that lump ore output from the feeder can enter the vibrating screen from the flow dividing component when the vibrating screen is started. According to the screening system and screening method, lump ore can be prevented from accumulating on the vibrating screen, and the powder screening difficulty of the vibrating screen is reduced.
Owner:SGIS SONGSHAN CO LTD

Method and system for combing firewall policies based on network traffic in Internet of Things

The invention relates to a method for combing firewall policies based on network traffic in the Internet of Things, which comprises the following steps of: collecting TCP network traffic data from a source address to a destination address and from a destination port to obtain original data, and performing data processing on the original data to obtain traffic data of three handshakes; carding the obtained traffic data of the three-way handshake according to a source address or a destination address, and outputting a carding result; according to the embodiment of the invention, sorting is carried out by counting the flow data and counting the source address, the destination address and the destination port of the field, and targeted screening is carried out according to the sorting result, so that the problem caused by unreasonable configuration or configuration error is solved.
Owner:深圳铸泰科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products