44results about How to "Reduce the difficulty of screening" patented technology

The invention discloses a non-burst ceramic preparation device and method. A conveying line is rotatably connected to the middle part of the inner wall of a supporting frame, a clamping and cleaning mechanism is connected to the edge part of the back surface of the supporting frame, an electric sliding rail is connected to the edge part of the back surface of the supporting frame, and a sliding block is slidably connected to the middle part of the top end of the electric sliding rail; and vertical electric telescopic rods are symmetrically welded to the two sides of the top end of the slidingblock, and a fixing plate is welded to the middle parts of the top ends of the vertical electric telescopic rods. Through the clamping and cleaning mechanism, clamping and cleaning for ceramic can befacilitated, so that the clamping and cleaning difficulty for the ceramic is lowered, and the time needed for cleaning by manually overturning the ceramic in the prior art is shortened; and therefore,the labor cost is saved, the cleaning difficulty for the ceramic is lowered, the efficiency of ceramic production is improved, then later baking for the ceramic is facilitated, the difficulty of later baking for the ceramic is lowered, and meanwhile the ceramic baked in the later period is neater and more attractive.

The invention discloses a high throughput DNA multi-site precise base mutation method. Based on overlap-extension PCR high throughput, mutation is efficiently introduced into multiple sites of a target gene segment; the used primer is not a degenerate primer and is a mutant primer containing a precisely designed target mutant sequence; the length of the mutant sites is not only a single amino acidand can be continuous 1 to 5 amino acids; the primer is not synthesized through single DNA chains and is massively synthesized in an integrated chip by an oligonucleotide synthesizer; the magnitude of primer species can reach 10<4> to 10<5> species/batch; and by adjusting the reaction conditions, the mutation frequency can be controlled to a certain degree. The provided mutation database foundation method can obtain a great amount of effective mutants; the database foundation mutant positive rate (non-synonymous amino acid mutation) can reach 80%; after subsequent high throughput screening, the established mutant library can be used as a powerful tool for obtaining ideal proteins and nucleic acid modifiers.

The invention discloses a sandstone screening machine for transportation construction. The sandstone screening machine comprises a rack, wherein a feeding barrel is arranged on the left side of the rack; a lifting assembly is arranged on the left side of an inner cavity of the rack; a guiding assembly communicates with the clearance between the lower end of the feeding barrel and the left side wall of the lifting assembly; a stirring assembly is arranged on the right side of the inner cavity; a square tube communicates with the clearance between the upper ends of the stirring assembly and thelifting assembly; a screening assembly is connected with the right side wall of the inner cavity of the rack; a discharging assembly is arranged below the screening assembly; and a first transmissionassembly is connected with the upper part of the rack. The sandstone screening machine is reasonable in structural design; through the sandstone screening machine, a sandstone material can be screenedtwice, and then sandstone particles which meet specifications can be obtained; the arrangement of power equipment can be eliminated, and then the energy consumption cost can be reduced; and the sandstone material can be subjected to pre-dehydrating treatment, the load of subsequent equipment can be reduced, and then the sandstone screening difficulty can be reduced.

The invention relates to a reaction system of screening arsenic ion aptamers by means of a colorimetric method for optimizing an aptamer sequence of arsenic ions and detecting arsenic ions in water. The reaction system is characterized by comprising a nucleotide sequence, a nanogold solution and a sodium chloride solution, wherein the nucleotide sequence is TTA CAG AACAACCAACGTCGCTCCGGGTACTTCTTCATCG, TTA CAGAACAACCAACCCGGGTACTTCTTCATCG, TAG GGAGAT ACCAGC and TTACAGAACAACCGGTACTTCTTCATCG. The invention also provides an application of detecting arsenic ion concentration by means of the colorimetric method. As the screening process is simple and fast, an auxiliary reagent is relatively easily obtained, and measurement can be performed by means of naked eye judgment or a spectrophotometer, so that the screening difficulty of the aptamers is greatly reduced, and immobilized application and fast detection are facilitated.

The invention relates to an energy storage system and a method for storing energy by using cascaded battery packs and belongs to the field of energy. The flexibility of second cascaded utilization canbe improved, the design flexibility of the energy storage system is improved, and different needs of different customers can be satisfied. The energy storage system includes at least two series branches which comprise directly used cascaded battery packs and voltage conversion modules, the directly used cascaded battery packs and voltage conversion modules are connected in series, and the at least two series branches are connected in parallel. The voltage conversion modules are used for converting the voltage of the directly used cascaded battery pack connected to the voltage conversion modules in series into preset voltage, and the preset voltage of all the series branches is the same.

The present invention provides a method of site-directed insertion to H11 locus in pigs by using site-directed cutting system, includes the following steps: 1) identify the targeted sequence targeted by the targeted cutting system in the targeted genome sequence of pigs; 2) design and construct the targeting sequence of the corresponding cutting system according to the targeted site; 3) construction of targeting vector; 4) transfect cells, identify the efficiency of fixed-point insertion by PCR amplification. The invention is dependent on the site-directed cutting system of H11 locus in pigs, to insert the target gene into the target site, in order to solve the problems such as low efficiency of traditional shooting technique, inconvenience design of PCR detection primer, harder to detect. The invention provides a method of site-directed insertion which can stably express the foreign gene at the H11 locus, to build an efficient platform for the production of transgenic pigs.

The invention provides a screening method for active substances of plants. The screening method comprises the following steps: (a) separating and purifying tubulins from pig brains; (b) performing fluorescence labeling on the tubulins to obtain fluorescence labeled tubulins; (c) mixing the tubulins, the fluorescence labeled tubulins and substances to be screened and performing a polymerization reaction; (d) performing microscopic observation on a polymerization product to obtain a microscopic picture; quantifying the quantity, length and roughness of the tubulins in the microscopic picture through applying computer software; carrying out conversion analysis on data and determining the activity of the substances to be screened according to a result. According to the screening method, the tubulins of the pig brains are subjected to the fluorescence labeling under an in-vitro condition, and the density, length frequency distribution and the like of the tubulins after the polymerization reaction are quantified by applying the computer software and are used as evaluation indexes for measuring factors influencing nucleation, elongation or reduction of the tubulins, so that the influences on the polymerization of the tubulins by the active substances of the plants are judged and a method model is provided for high-throughput screening researches for digging the active substances of the plants.

The invention discloses an aggregated rock screening device for an industrial building. The aggregated rock screening device comprises a feeding table, a first supporting frame, a driven transmissionwheel, a driving grinding roll, universal wheels, a discharging plate, a second supporting frame, a driven adjusting gear, a gear motor, a screening motor, an annular steel ring, a screening rod, a screening barrel, a driving motor, a screening mesh, a conveying belt, a feeding baffle, a driving transmission wheel, a driving adjusting gear, a fixed rod, a driven grinding roll, a bevel gear, a transmission motor, a driving belt wheel, a driven belt wheel, a discharging funnel, a fixed frame, a discharging baffle, a driving gear and a driven driving gear. A feeding table is fixed to the top of the first supporting frame. According to the aggregated rock screening device, aggregated rock conveyed up by the conveying belt is primarily screened through the screening mesh, and the aggregated rock moves towards the next processing position under the action of the gravity of itself in the screening process; the structure is simple, and operation is convenient; and the time consumed by manual moving of the aggregated rock is saved, and the work efficiency is improved.

The embodiment of the invention discloses a method, a device and equipment for screening an upper gastrointestinal endoscopic image, and a storage medium. The method comprises the following steps: inputting each endoscopic image in an endoscopic image set of an upper digestive tract into a pre-trained part classification model to obtain a part category of each endoscopic image; inputting all the endoscopic images of each part into a pre-trained target detection model to obtain a target image set of each part; classifying each target image map in the target image map set according to a pre-trained classification model to obtain a classification result of each target image map; and screening the endoscopic images in the target image set of each part according to the classification result to obtain the screened endoscopic images. Based on the artificial intelligence technology, the screening difficulty of the endoscope images is reduced, the screening time of the endoscope images is saved, and the quality and accuracy of subsequently generated endoscope reports are improved.

The invention provides a breeding method of specified-pathogen-free experimental pigs and application of the breeding method of the specified-pathogen-free experimental pigs, and relates to the technical field of breeding of experimental animals. The provided breeding method of the specified-pathogen-free experimental pigs comprises the following steps: making pathogen-free pregnant sows have natural deliveries in a sterile environment, transferring delivered piglets into a barrier environment, and after feeding is conducted for at most 14 days, conducting weaning to obtain the specified-pathogen-free experimental pigs, wherein feeding comprises intestinal probiotic feeding, artificial milk feeding, and solid feed ingestion induction. By means of the provided breeding method of the specified-pathogen-free experimental pigs, not only are the problems of low quality and long time of experimental pigs obtained through an ordinary method solved, but also the delivery technology and obtaining cost is controlled in a low range, and the fact that the high-quality specified-pathogen-free experimental pigs are obtained from breeding can be guaranteed at the same time.

The invention discloses a task scheduling method, based on virtual partitioning, for a reconfigurable system. According to the method, task significance parameters are defined according to the reappearance frequency of tasks, virtual partitioning is carried out on reconfigurable resources, and partitioning management is carried out on the tasks at different significance levels. When task significance values are increased, some tasks are transferred from one partition to another partition. When the tasks are completed, the configuration of the tasks is retained as far as possible instead of being removed from the reconfigurable resources; when the same tasks reappear, computation can be directly carried out, so that the configuration frequency is decreased and the reconfiguration expenditure is lowered. Even though the probability of reuse of the tasks can be increased by retaining the configuration of the completed tasks on the reconfigurable resources, idle resources of the reconfigurable resources can be reduced at the same time. When new tasks arrive, if the idle resources are not enough, the sizes of the partitions are modified according to certain conditions; if the idle resources are still not enough, one or more retained tasks are selected from the partition where the tasks at the lowest significance level are placed, and the retained tasks are replaced by the new tasks.

The invention discloses an urban waste classified recovery device for municipal engineering. The urban waste classified recovery device comprises a first box body and a second box body, wherein a feeding opening is formed in the top of the first box body, and a filtering plate is arranged below the feeding opening; a material receiving box is arranged at the bottom of the first box body, a first supporting plate is arranged on the inner wall of the first box body, and a first driving motor used for driving the first supporting plate to be matched is arranged on the side wall of the first box body; and a scraper matched with the filtering plate is arranged in the first box body, a first opening is formed in the side wall of the first box body, and clear water is contained in the second boxbody. Filtered objects are screened under the buoyancy effect of the clear water, so that disposable chopsticks and plastic bags float on the water surface, bones, metal and other garbage are precipitated at the bottom of the second box body, therefore the disposable chopsticks and the plastic bags are directly collected, the garbage screening difficulty is reduced, and garbage screening is more convenient.

The invention discloses a corn threshing device for livestock feed production. The corn threshing device comprises a threshing barrel, a feeding hopper is fixedly installed on the inner wall of the top of the threshing barrel, a clamping plate is connected to the inner wall of the bottom of the feeding hopper in an attached mode, a moving rod is fixedly connected to the right side of the clamping plate, a sliding column is fixedly installed on the outer wall of the moving rod, and a crankshaft is slidably connected with the outer wall of the sliding column. According to the corn threshing device for livestock feed production, firstly, corn is poured into the feeding hopper, the corn enters the threshing barrel through the component of the clamping plate, meanwhile, a main motor drives a main shaft rod and a main threshing barrel to rotate through a movable shaft, the main shaft rod drives a secondary shaft rod through a transverse rotating belt, then a secondary threshing barrel rolls, and the corn is extruded between the rolling main threshing barrel and the rolling secondary threshing barrel, so that threshing treatment of the corn is facilitated, manual feeding operation of a single corn cob is avoided, manpower waste is reduced, the workload of a user is reduced, and the corn threshing device is suitable for production and processing of a small amount of feed.

The invention is suitable for the field of traditional Chinese medicine and provides a method for screening active ingredients of traditional Chinese medicine. The method comprises the following steps: preparing a chromatographic column; preparing Danhong sample liquid; and screening through the chromatographic column. The method successfully screens out the active ingredients for cardiovascular and cerebrovascular diseases in Danhong injection, the screening efficiency is improved, and meanwhile the safety of the Danhong injection is greatly improved.

The present disclosure relates to an area color matching method and apparatus, an electronic device, and a computer-readable storage medium. A region color matching method includes determining a target region within a real scene; Acquiring an actual color of a region around the target region; Determining a target color of the target area according to the actual color based on a preset color matching principle. As that target color of the target area is determine according to the actual color of the area around the target area in the embodiment of the present disclosure, the target color can bematched with the surrounding color, the color matching effect can be improve, and the experience of using the augmented reality device can be realized.

The invention discloses a method for displaying, searching and linking geographical information or a product on an administrative division map. The method comprises the steps that according to displayrequirements of information or product, an appropriate administrative division map geographic level is selected, the information or product of each area is selected, a name and picture of the information or product and a link interface linking detailed information of the information or product are marked on the administrative division map of the area, and a plurality of key word search links areprovided for each piece of information or product. The method for displaying, searching and linking the geographical information or the product on the administrative division map has the advantages that the information or product can be comprehensively displayed, so that the display chances of all information or products are more equal, the threshold of an industry is effectively lowered, the product display effect is good, the product screening difficulty is smaller, a user can pre-consult the displayed products, more choices can be provided for the user, the user can click and consult information according to his or her interest, the searching and linking method is more user-friendless, and the practical performance is higher.

A new energy vehicle, a power supply control method and a storage medium, belonging to the technical field of new energy vehicles. It includes a central control module, a power management module and a battery array. The power management module is connected to the central control module. It is characterized in that: a battery adaptation module and a voltage acquisition module corresponding to the battery modules in the battery array are provided, and the battery adaptation module and The voltage collection module is connected to the power management module; a power collection module and a temperature collection module are provided, and the output terminals of the power collection module and the temperature collection module are connected to the power management module; a temperature regulation module connected to the battery array is also provided, The power management module is bidirectionally connected with the temperature regulation module to regulate the temperature of the battery array. In this application, the idea of ​​equalizing the battery in series to control battery voltage or capacity is abandoned, eliminating the waste of capacity energy and power loss caused by equalization, and realizing adaptive power supply for new energy vehicles.

The invention discloses a screening system and screening method for wet powder-containing lump ore, and belongs to the field of lump ore screening. The screening system for wet powder-containing lumpore comprises a feeder, a vibrating screen and a flow dividing mechanism, wherein the input end of the vibrating screen is arranged below a discharge port of the feeder, the flow dividing mechanism comprises an elastic component and a flow dividing component, the elastic component is installed at the input end of the vibrating screen, and the flow dividing component is supported between the inputend of the vibrating screen and a discharge port of the feeder through the elastic component so that lump ore output from the feeder can enter the vibrating screen from the flow dividing component when the vibrating screen is started. According to the screening system and screening method, lump ore can be prevented from accumulating on the vibrating screen, and the powder screening difficulty of the vibrating screen is reduced.

The invention relates to a method for combing firewall policies based on network traffic in the Internet of Things, which comprises the following steps of: collecting TCP network traffic data from a source address to a destination address and from a destination port to obtain original data, and performing data processing on the original data to obtain traffic data of three handshakes; carding the obtained traffic data of the three-way handshake according to a source address or a destination address, and outputting a carding result; according to the embodiment of the invention, sorting is carried out by counting the flow data and counting the source address, the destination address and the destination port of the field, and targeted screening is carried out according to the sorting result, so that the problem caused by unreasonable configuration or configuration error is solved.