Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

123results about How to "Precise control ratio" patented technology

Reinforced aerogel composite material and preparation method thereof

The invention provides a reinforced aerogel composite material and a preparation method thereof. The reinforced aerogel composite material comprises single aerogel or two aerogels or more than two aerogels, the surfaces or block interfaces of the block aerogel are coated or bound into a whole by virtue of fiber mesh fabric-reinforced waterborne adhesive. The preparation method of the reinforced aerogel composite material comprises the following steps: (1) carrying out hydrophobic modification treatment on the surfaces; (2) carrying out hydrophilic / hydrophobic modification treatment on the surfaces; and (3) preparing the reinforced aerogel composite material: uniformly coating the surface of the block aerogel or the interface of two aerogels with waterborne adhesive and fiber mesh fabric and curing to obtain the reinforced aerogel composite material. The reinforced aerogel composite material provided by the invention has the characteristics of excellent thermal-insulation property, heat preservation property, sound insulation property, fireproof property, explosion resistance, shock absorption, energy absorption, light weight, better mechanical properties, the preparation process of the material is simple and practical and the material has wide range of applications.
Owner:NANJING WEICAI NEW ENERGY TECH

Air return temperature regulating sedan air conditioner

The invention related to air condition of saloon car, especially to air return thermoregulated air condition of saloon car. The air condition includes air intake dual duct, refrigeration air duct, and air out duct. A blower fan is setup in the air intake dual duct. Air inlet of air intake dual duct is composed of fresh air inlet, air return inlet, and regulating door for fresh air setup between the fresh air inlet and the air return inlet. Evaporator of air conditioning unit is setup in the refrigeration air duct. Characters are that conduction through air duct insulated from refrigeration air duct is added between the air intake dual duct and air out duct. Air outlet of the conduction through air duct, and air outlet of the refrigeration air duct are led to the air out duct. The invention is in favor of reducing energy consumption caused by heating blast of air condition repeatedly.
Owner:FUJIAN UNIV OF TECH

Preparation method of nitrogen-doped porous carbon-supported metal monoatomic material

The present invention relates to a controllable preparation method of a nitrogen-doped porous carbon-supported metal monoatomic material, and belongs to the technical field of material science and engineering. According to the present invention, porphyrin and a metalloporphyrin are polymerized through a polymerization reaction. The proportions of the porphyrin and the metalloporphyrin are regulated to regulate a metal content (0.06-4.00wt%), and monoatomic metal types (A type, AB type, ABC type) are regulated by regulating different types of metalloporphyrins. According to the present invention, controllable preparation of a metal monoatomic material is realized with good expansibility and reproducibility; meanwhile, the problems of low metal content, few types and the like in the prior art are solved, and researches in the related fields such as the synthetic methodology of metal monoatomic materials and the like.
Owner:SUN YAT SEN UNIV

Preparation method of amorphous sulfide solid electrolyte

The invention relates to the field of lithium ion batteries, in particular to a preparation method of an amorphous sulfide solid electrolyte. The preparation method of the amorphous sulfide solid electrolyte is characterized by mainly comprising the following steps: (1) putting metallic lithium, elemental sulfur, germanium sulfide and phosphorus pentasulfide in a certain proportion into a water-free and oxygen-free sealed container for mixing; and (2) mechanically grinding the raw materials mixed in the step (1) so as to prepare the amorphous sulfide solid electrolyte. According to the preparation method, the proportion of lithium, sulfur to phosphorus can be accurately controlled, and the problem that raw material volatilization in a high-temperature solid-phase method causes relatively low product purity is solved; and meanwhile, the resources of the raw materials are abundant, the process is simple, and the high-purity amorphous sulfide solid electrolyte can be obtained through a ball-milling one-step method.
Owner:SHANDONG YUHUANG NEW ENERGY TECH +1

Janus particle with chemotherapy/photo-thermal synergistic effect and preparation method thereof

The invention provides a Janus particle with a chemotherapy / photo-thermal synergistic effect and a preparation method thereof and belongs to the technical field of biomedicines, aiming at solving thetechnical problem that combined treatment of various methods on cancers is not easy to realize by other materials. The particle is of a gold-silicon dioxide / mesoporous silicon dioxide Janus nano-structure; a gold nanoparticle is reduced on the surface of an aminated mesoporous silicon dioxide semi-sphere in situ through a Pickering emulsion method and different medicines are loaded at two ends respectively. The gold nanoparticle modified aminated mesoporous silicon dioxide Janus particle is prepared through the Pickering emulsion method. The Janus particle provided by the invention can be usedfor loading the two medicines at the same time and the ratio of the two medicines can be accurately controlled; the two medicines can respond medicine releasing through external signal stimulation including pH (Potential of Hydrogen), oxidization reduction and the like, and the technical problem that sudden releasing of the medicines is caused by an existing medicine nano-carrier is solved.
Owner:SHANXI UNIV

Thickened composite film based on diamond-like carbon thin film and coating method of thickened composite film

The invention discloses a thickened composite film based on a diamond-like carbon thin film and a coating method of the thickened composite film. The thickened composite film based on the diamond-like carbon thin film comprises a transition layer and a diamond-like carbon layer which are successively formed from the surface of a substrate to the outside, wherein the transition layer at least comprises a metal base layer and a codeposition layer; and the codeposition layer comprises is fusion of metal carbide and metals corresponding to metal elements in the metal carbide. By the codeposition layer, the nano hardness range can be expanded effectively, and then the thickness of the diamond-like carbon layer can be increased; moreover, huge stress caused by the thick diamond-like carbon layer can be buffered effectively, and the binding force of the composite film and the substrate is increased; and meanwhile, a surface microstructure of the codeposition layer is good, the roughness of DLC cannot be damaged, and therefore, the composite film has low friction coefficient.
Owner:STARARC COATING TECH SUZHOU

Search engine sorting method and system and search engine

The invention provides a search engine sorting method and system and a search engine. The method comprises the following steps: obtaining a candidate search result set, wherein the candidate search result set comprises one or a plurality of search results; dividing the search result or the search results into a plurality of subsets; and respectively extracting search results from the subsets to generate an exhibition page. According to the invention, the global sorting optimization of the research results can be realized, and the quantity, the position and the proportion of one or multiple characteristics are precisely controlled.
Owner:ALIBABA GRP HLDG LTD

Thermostatic dehumidifying device for air-conditioner

The invention provides a thermostatic dehumidifying device for an air-conditioner. The thermostatic dehumidifying device comprises an electronic expansion valve, a first heat exchange coil pipe, a throttle valve bank and a second heat exchange coil pipe, which are sequentially connected in a refrigerant pipeline in series, and are also sequentially arranged in an air channel of an indoor unit of the air-conditioner in the windward direction. With the electronic expansion valve and the throttle valve bank, in the refrigerating mode of the air-conditioner, a refrigerant enters the first heat exchange coil pipe to refrigerate and then enters the second heat exchange coil pipe to refrigerate again, so that the refrigerating capacity is increased, and the heat exchange efficiency of the air-conditioner is improved. In the dehumidification mode, air firstly passes through the second heat exchange coil pipe to be cooled and dehumidified, the air is heated when passing through the nearby position of the first heat exchange coil pipe, so that the indoor air is heated again after being dehumidified and cooled, the effect of thermostatic dehumidification is realized, and the demands of people on temperature and humidity are met.
Owner:HAIER GRP CORP +1

Alloy powder and method for synchronously sending powder and welding galvanized steel sheet and AZ91D magnesium alloy based on laser

The invention discloses an alloy powder and method for synchronously sending powder and welding a galvanized steel sheet and AZ91D magnesium alloy based on laser. A main component of the powder is AlMgxCuZn, wherein x is the mole ratio of Al and Mg, the ratio range is between 0 and 0.4, the size of the powder is 100 meshes to 300 meshes, and a process method which is matched with the alloy powder and method for synchronously sending the powder and welding the galvanized steel sheet and the AZ91D magnesium alloy based on the laser can improve wettability and compatibility between the galvanized steel sheet and AZ91D magnesium alloy. According to the alloy powder and method for synchronously sending the powder and welding the galvanized steel sheet and the AZ91D magnesium alloy based on the laser, the laser is taken as a welding hot source, under the protection of protective gas and the hot effect, a part of the surface of a material to be welded melts, through effective sending of the alloy powder, a stable weld pool is easily obtained, burning loss of alloying elements is reduced, the ratio of the alloying elements in a weld joint can be accurately controlled, a formula for filling the alloying powder is flexible, metallurgy action of weld metal can be remarkably improved, the weld joint without inclusions can be obtained especially aiming at the existence of Zn, a welding surface needs no special cleaning, welding efficiency is high, cost is low, the joint is reliable, and the alloy powder and method for synchronously sending the powder and welding the galvanized steel sheet and the AZ91D magnesium alloy based on the laser has relatively ideal engineering practical significance.
Owner:SHANGHAI UNIV OF ENG SCI

High-efficiency pulp modifying machine for molybdenum tungsten ore flotation technology and implementation method thereof

The invention relates to a high-efficiency pulp modifying machine, which comprises a pulp mixing box, a material silo connected to the lower part of a side surface of the pulp mixing box and a medicament barrel connected to the bottom of the pulp mixing box. The pulp mixing box comprises a box body and a rotating shaft assembly which is rotatably connected to the box body. An air compressor and amotor are arranged on the upper surface of the box body. The rotating shaft assembly comprises a rotating shaft body, a drug spray bin arranged below the rotating shaft body, and an air inlet connecting pipe and a drug inlet connecting pipe which are respectively arranged at the upper end and lower end of the rotating shaft body. A discharging pipe is arranged at the lower part of a side surface of the material silo. The discharging pipe is provided with a first feed pump. A drug outlet pipe is arranged at the lower part of a side surface of the medicament barrel. The drug outlet pipe is provided with a second feed pump. The invention also provides an implementation method of the high-efficiency pulp modifying machine for the molybdenum tungsten ore flotation technology, comprising the following steps: mineral grinding; pulp blending; pulp modification; and pulp flotation. The high-efficiency pulp modifying machine of the invention has strong reliability. By the adoption of the high-efficiency pulp modifying machine, pulp and a medicament are fully mixed, cost is saved, and flotation precision and yield of mineral are raised.
Owner:中国黄金集团中原矿业有限公司

Automatic rice washing all-in-one machine capable of realizing visual storage and convenient and fast metering

The invention relates to an automatic rice washing all-in-one machine capable of realizing visual storage and convenient and fast metering. The automatic rice washing all-in-one machine is characterized in that a rice storage cabin is arranged above a machine case, a washing cabin is arranged in the middle position of the machine case, a rice outlet is arranged at the bottom of the rice storage cabin and is communicated with the washing cabin, the rice outlet part of the rice storage cabin is provided with a transverse clamp groove and a control gate plate, the washing cabin is designed into a structure with the arc-shaped curve cross section, a volume scale is marked at one side surface near the washing cabin, the upper edge opening part of the washing cabin is provided with a water inlet communicated with a water inlet spray pipe, when the water inlet spray pipe fills water into the bottom of the cabin, the water flow can form the upwards and downwards turning vertical eddy flows under the effect of the arc-shaped curve cabin body, rice grains are driven to be automatically washed, and a transverse clamp groove and a water sealing gate plate provided with a washing sieve screen are arranged at a water outlet and rice outlet part arranged at the bottom of the washing cabin. The all-in-one machine can complete the automatic rice washing and can realize the complete separation of swill and rice grains, the expected rice boiling effect can be obtained through controlling the rice-water proportion according to the requirements, the rice storage quantity can be conveniently observed, the condition that the rice is used up when people want to cook is avoided, the manual operation is adopted, the electricity consumption is avoided, the time and the water are saved, and the emission is reduced.
Owner:郑子开

Lithium ferric manganese phosphate cathode material and manufacturing method thereof

The invention provides a lithium ferric manganese phosphate cathode material and a manufacturing method thereof. By using sheet iron, scrap iron, iron slag, inorganic ferric salt, ferric oxide or organic iron and manganic carbonate, manganese oxide, a lithium source and the like are added into a diluted phosphoric acid solution to synthesize and prepare the high voltage platform lithium battery cathode material, namely lithium ferric manganese phosphate. The lithium ferric manganese phosphate produced in the invention is extremely low in impurity content, the product has high dispersibility and flowability, the polarization ratio is more than 0.95 respectively; the size distribution is in a relatively narrow range, wherein D50 is stabilized about 5 microns. An SEM electron microscope indicates that the product is sheet-like in shape and has extremely high compaction density, and XRD also indicates that the obtained lithium ferric manganese phosphate product is pure-phase, namely is a lithium ferric manganese phosphate product of an orthogonal plate-like / sheet-like structure. Through the test of a button cell simulating battery prepared from the materials, a voltage platform is fundamentally 4.18 to 4.2 V, and the 0.1C capacity reaches 161 to 165 mAh / g.
Owner:深圳市北宸创新材料科技有限公司

Method and device for preparing adiponitrile

The invention provides a method and a device for preparing adiponitrile. The preparation method comprises the steps of a first hydrocyanation reaction, an isomerization reaction and a second hydrocyanation reaction. According to the method, the contents of specific components in a system is detected by adopting an online Raman spectrum, and reaction conditions are regulated and controlled based ona detection result, so accurate control on materials in each step in the reaction system is realized. The method provided by the invention can reduce the consumption of butadiene, and lower subsequent butadiene recovery energy consumption and equipment investment in the reaction; the content of hydrocyanic acid is monitored in real time, so hydrocyanic acid residues are reduced to a relatively low level, and the operation safety and the stability of a catalyst in the reaction process are improved; and the loss of the catalyst is reduced.
Owner:ZHEJIANG NHU CO LTD +2

Preparation method and application of high-purity lithium cobalt oxide cathode material

The invention belongs to the field of lithium ion batteries, and in particular relates to a preparation method and application of a high-purity lithium cobalt oxide cathode material. The invention discloses a preparation method of the high-purity lithium cobalt oxide cathode material and a lithium ion battery prepared from the high-purity lithium cobalt oxide cathode material. The preparation method comprises the following steps: embedding cobaltosic oxide into lithium ions by using an electrochemical method, and annealing, thereby obtaining the high-purity lithium cobalt oxide cathode material. By controlling the discharge amount, the ratio of lithium to manganese can be precisely controlled, and thus the high-purity lithium cobalt oxide cathode material can be prepared. As the cathode of the lithium ion battery, the lithium cobalt oxide prepared by using the preparation method is very good in cycle performance.
Owner:SHANDONG YUHUANG NEW ENERGY TECH

Nucleic acid aptamer and its circular bivalent nucleic acid aptamer-drug coupling system and application thereof

The present invention discloses a nucleic acid aptamer and its circular bivalent nucleic acid aptamer-drug coupling system and an application thereof. The system comprises a nucleotide sequence of X-GCTCATAGGGTTAGGGGCTGCTGGCCAGATACTCAGATGGTAGGGTTACTATGAGC, wherein: X is absent (SEQ ID NO: 1), or is one of the TGACTGATTTACG (SEQ ID NO: 2) and CGTAAATCAGTCA (SEQ ID NO: 3) sequences. The nucleic acidaptamer of the invention has good affinity for various cancer cells, and after modification, the nucleic acid aptamer can be combined with various anticancer drugs to make the drug targeted, and theutilization rate of the drug is increased, a monomer linked to the drug after modification can also be prepared into the nucleic acid aptamer-drug coupling system, which is loaded with a plurality ofdrugs, and synergistic effect of drugs is achieved. The drug effect is improved, the circular divalent nucleic acid aptamer-drug coupling system is simple and efficient in synthesis, and does not require complicated reactions, and provides a new method for multi-drug combination therapy.
Owner:HUNAN UNIV

Smart rice cooker and material feeding assembly for same

The invention discloses a smart rice cooker, comprising a body with a heater at the bottom, a liner in the body, a cover on the upper side of the bod, a material feeding assembly on one side of the body, and a remote control unit. A heating area, a rotating shaft area and a water channel area are separated but cooperate mutually without interference; position of a material storage bin is adjustedthrough a rotating shaft mechanism so that automatic material feeding and automatic closing are achieved while yielding to the cover to allow the cover to close the body is realized; food materials inthe storage bin are distributed and metered automatically through an electric distributor, which is accurate in metering and simple and convenient in material distributing. The food materials can becleaned automatically through a washing box, waste water can be recovered, manual involvement is omitted, and a diversified and intelligent way for cooking rice is realized. With the material feedingassembly for the smart rice cooker, customers can remotely control material feeding and washing, water adding, start of heating and the like; as weight and proportion of food materials and water is controlled accurately, the automatic rice cooking function is achieved.
Owner:王晓晖

Electrochemical preparation method of solid electrolyte lithium aluminum titanium phosphate

The invention relates to the technical field of lithium ion batteries, in particular to an electrochemical preparation method of solid electrolyte lithium aluminum titanium phosphate. The electrochemical preparation method comprises the following steps of firstly, preparing a mixture of aluminum oxide and titanium dioxide according to the ratio of aluminum to titanium; secondly, embedding the titanium dioxide into lithium ions through an electrochemical method; thirdly, adding phosphor salts according to the ratio of lithium to aluminum to titanium to phosphorus to form a uniform mixture, and annealing to obtain an LATP solid electrolyte. The electrochemical preparation method disclosed by the invention is low-priced in raw materials and is simple in process; high-purity lithium aluminum titanium phosphate can be obtained by an electrochemical step and a high-temperature treatment step; the ratio of the lithium to the aluminum to the titanium to the phosphorus can be accurately controlled, and the problem that the purity of products is lower caused by volatilization of lithium salts at high temperature in a general solid-phase method is solved.
Owner:SHANDONG YUHUANG NEW ENERGY TECH +1

Dehydrated tailing precise blending and forced homogenizing preparation structural flow filling technology and filling system

PendingCN111322108AAccurately control the mix ratioControl quality costMaterial fill-upAutomatic controlControl system
The invention provides a dehydrated tailing precise blending and forced homogenizing preparation structural flow filling technology and filling system. The filling system is composed of a feeding andmetering subsystem, a stirring and preparing subsystem, a slurry conveying and filling subsystem and an automatic control system. The feeding and metering subsystem comprises a dehydrated tailing feeding and metering system, a concentrated water feeding and metering system and a cementing agent feeding and metering system. The filling technology realizes advanced material preparation, precise metering and forced activation cycle preparation and storing offset adjustment two-section stirring. The filling material ratio and filling slurry mass concentration can be accurately controlled, high-concentration homogeneous steady-state structural flow filling slurry is prepared, and the filling slurry preparation quality and filling cost are controlled. The technology and the system have strong adaptability to mining of unbalanced mines and can be used for mines with mechanically dehydrated tailing, tailing pond sand and the like as aggregates, the construction investment is saved, the periodis short, and the technology and the system are applicable to filling and station establishment of mines in various scales.
Owner:CHINA MINMETALS CHANGSHA MINING RES INST +1

Preparing method and application of high-purity lithium manganate anode material

The invention belongs to the field of lithium ion batteries, and particularly relates to a preparing method and application of a high-purity lithium manganate anode material. A lithium ion battery prepared from the high-purity lithium manganate anode material is also disclosed. Manganese dioxide is embedded into lithium ions by means of the electrochemical method, and then annealing is conducted to generate the high-purity lithium manganate material. The proportion of lithium to manganese can be accurately controlled by controlling discharge electric quantity, so that the high-purity lithium manganate material is obtained. The lithium manganate material prepared with the method has extremely high cycle performance as the anode of the lithium ion battery.
Owner:SHANDONG YUHUANG NEW ENERGY TECH

System for improving outlet temperature adjustment flexibility of coal mill

PendingCN111359765AReduce the ratio of primary air to hot airGuaranteed temperatureGrain treatmentsAir preheaterCold air
The invention discloses a system for improving the flexibility of outlet temperature adjustment of a coal mill. The system comprises a primary air fan (1), an air preheater (2), the coal mill (3) anda bypass cold air pipeline (4), wherein the outlet of the primary air fan (1) is divided into two paths, one path is communicated with the inlet of the coal mill (3), the other path is communicated with the inlet of the air preheater (2), the outlet of the air preheater (2) is communicated with the inlet of the coal mill (3), and the bypass cold air pipeline (4) is communicated between the inlet and the outlet of the air preheater (2). The bypass air pipelines are additionally arranged on the front pipeline and the rear pipeline of the primary hot air side of an original air preheater, so thatthe primary air volume entering the air preheater for heating is adjustable, when the moisture of coal for actual combustion is low, the primary air volume entering the air preheater is reduced through the arranged bypass air channels, the primary air-hot air ratio of the inlet of the coal mill is reduced, and the outlet temperature of the primary air-powder mixture is ensured to meet the designrequirement.
Owner:XIAN THERMAL POWER RES INST CO LTD +2

Integrated anammox membrane boelectrochemical system and sewage denitrification and decarbonization treatment technology

The invention provides an integrated anammox membrane boelectrochemical system and a sewage denitrification and decarbonization treatment technology. The integrated anammox membrane boelectrochemicalsystem comprises an anode chamber, a cathode chamber and a membrane biological pool; a positive ion exchange membrane is arranged between the membrane biological pool and the anode chamber, a negativeion exchange membrane is arranged between the membrane biological pool and the cathode chamber, the anode chamber is internally provided with an anode material, the cathode chamber is internally provided with a cathode material and an aeration device, and the cathode material and the anode material are connected through an external circuit provided with a resistance-value-adjustable rheostat. Accordingly, by efficiently coupling a microorganism electricity generation technology, a membrane filtration technology and an anaerobic ammonium oxidation technology, according to the concentration ofNH4<+>-N in sewage, the resistance value of the rheostat is adjusted, the proportion of ammonia nitrogen and nitrite nitrogen in the anaerobic ammonia oxidation process can be precisely controlled, operation is easy, convenience is brought to control, the sewage treatment efficiency is high, and the system has the wide application prospect.
Owner:HEBEI UNIVERSITY

Preparation method for aluminum-doped zinc oxide (AZO) nano array

The invention provides a preparation method for an aluminum-doped zinc oxide (AZO) nano array. The method is performed as follows: precisely controlling the concentration of chemical reaction solution by continuously injecting growing sources and doping sources at a constant speed to controllably prepare an aluminum-doped zinc oxide (AZO) array with high carrier concentration; compounding the aluminum-doped zinc oxide (AZO) array and a nickel oxide material to obtain a capacitor electrode material with high electricity capacity. The capacitor electrode material with high electricity capacity is attained in such a way that an aluminum-doped zinc oxide (AZO) array with high conductivity prepared by a continuous flow injecting method and a nickelnanosheet material with poor conductivity but high electricity capacity are combined. In comparison to a conventional hydrothermal method, the carrier concentration obtained from the preparation method provided in the invention increases three orders of magnitude. In the method, an aluminum-doped zinc oxide (AZO) material with high carrier concentration and a nickel oxide with poor conductivity are combined such that the advantages of the two materials are brought into full play and the electricity capacity of a capacitor is substantially increased. Beyond that, the continuous flow injecting and doping method provides a new idea for controllable precise doping. The method is simple in operation, cost-effective and enjoys great application prospects.
Owner:UNIV OF SCI & TECH BEIJING

Cold precipitation tank for degreasing cannabidiol in industrial cannabis sativa

The invention discloses a cold precipitation tank for degreased cannabidiol in industrial cannabis sativa, the cold precipitation tank comprises a cold precipitation tank body, a fine control blanking device, a support frame, a refrigerator, a controller, a material stirring and dissolving device and a dynamic wax removal filtering device, the support frame is arranged on the upper wall of the cold precipitation tank body, the fine control blanking device is arranged at the upper end of the support frame, and the refrigerator, the controller, the material stirring and dissolving device and the dynamic wax removal filtering device are arranged in the cold precipitation tank body; and the material stirring and dissolving device comprises a stirring and filtering tank, a stirring motor, an electric push rod, a motor fixing plate, a rotating shaft, stirring blades, a lower fixing frame, a bearing plate, a lower connecting rod and a lower baffle. The invention belongs to the technical field of extraction and separation of chemical components of natural plants, and particularly provides the cold precipitation tank for degreased cannabidiol in industrial cannabis sativa, which is convenient for accurately controlling the ratio of ethanol to an extract, facilitating uniform mixing and dissolving of materials and effectively separating filtrate and flocculent floating objects.
Owner:温州市金榜轻工机械有限公司

Crushing and uniform mixing integrated intelligent remediation equipment for soil remediation

The invention discloses crushing and uniform mixing integrated intelligent remediation equipment for soil remediation. The equipment comprises a feeding system, a chemical adding system, a crushing and mixing system, a discharging system and an automatic control system, the feeding system conveys crushed and screened contaminated soil to the position below the chemical adding system, the chemicaladding system releases chemicals, the soil and the chemicals are crushed and mixed through the crushing and mixing system, and then mixed materials are conveyed to the outside through the dischargingsystem to be maintained and recycled; the driving system is responsible for driving the whole equipment to run and walk; and the automatic control system is responsible for controlling the automatic control operation of the whole equipment. According to the method, feeding, crushing and mixing integrated operation in soil remediation is achieved, manpower, material resources and financial resources are saved, efficient solidification / stabilization remediation of the heavy metal contaminated soil is achieved, and the method particularly has a good remediation effect on the heavy metal compositecontaminated soil.
Owner:GUANGXI BOSSCO ENVIRONMENTAL PROTECTION TECH

Holothurian culture equipment

The invention relates to the technical field of aquaculture, in particular to holothurian culture equipment. The holothurian culture equipment comprises a base and a culture box, and further comprisesa controller, a digital display thermometer, a sun shading mechanism, a water level adjusting mechanism and a feeding mechanism; the sun shading mechanism comprises a sun shading net and a driving assembly, and the water level adjusting mechanism comprises a collecting box, a traction assembly, an extraction assembly and a conveying assembly; and the feeding mechanism comprises a batching tank and a sliding assembly, the sliding assembly is arranged in the culture box, the batching tank is arranged in the sliding assembly, and the digital display thermometer, the driving assembly and the conveying assembly are all electrically connected with the controller. According to the holothurian culture equipment, sun shading and water level adjustment are carried out synchronously, so that holothurian can be effectively prevented from being harmed by bottom oxygen deficit and bottom mud stinking of an aquaculture water body; and meanwhile, various kinds of holothurian feed can be accurately matched, so that the holothurian can conveniently eat and absorb nutrients, the power consumption is relatively low, and the culture cost is favorably reduced.
Owner:烟台立尚海水养殖有限公司

Preparation method for amorphous state sulfide solid electrolyte

The invention relates to the field of a lithium ion battery and specifically to a preparation method for an amorphous state sulfide solid electrolyte. The preparation method for the amorphous state sulfide solid electrolyte is characterized by comprising the following steps of (1) putting metal lithium, elemental sulfur and phosphorus pentasulfide into an anhydrous and oxygen-free sealed container for mixing; and (2) performing mechanical grinding on the mixed raw materials obtained in the step (1) to obtain the amorphous state sulfide solid electrolyte. According to the preparation method, the proportion of lithium to sulfur to phosphorus can be accurately controlled; the problem of a relatively low purity of the product caused by raw material volatilization existing in a high-temperature solid state method is solved; and meanwhile, the preparation method is rich in raw material sources and simple in process; and the high-purity amorphous state sulfide solid electrolyte can be obtained in one step by a ball milling method.
Owner:SHANDONG YUHUANG NEW ENERGY TECH +1

Synthesis method of mixing ketoxime type cross-linking agent

The invention relates to a synthesis method of a mixed ketoxime type cross-linking agent, belonging to the field of silane cross-linking agent synthesis. The synthesis method comprises the steps: reacting propyl trichlorosilane, phenyl trichlorosilane and diacetylmonoxime as raw materials to generate a mixture of propyl tri-diacetylmonoxime silane (ProS) and phenyl tri-diacetylmonoxime silane (PhOS); and after reaction is finished, standing and layering, removing lower-layer diacetylmonoxime hydrochloride, introducing ammonia gas to the upper-layer half-finished product for neutralizing, filtering to remove white solid ammonium chloride, and then distilling to obtain the mixed ketoxime type cross-linking agent. According to the invention, the ratio of PrOS to PhOS in the mixed cross-linking agent can be accurately controlled according to the use requirement of the cross-linking agent; and the synthesis method has the advantages of simplicity in operation, stable quality, high reactionconversion rate, high yield, low diacetylmonoxime consumption, low production cost and the like; and the whole process has no wastewater generation and has no environmental pollution.
Owner:JINGZHOU JIANGHAN FINE CHEM

Liquid proportioning mixer

The invention discloses a liquid proportioning mixer. The liquid proportioning mixer comprises a spiral liquid outlet pipe, and the upper end of the liquid outlet pipe is fixedly connected with an electromagnetic valve; the liquid proportioning mixer also comprises a stirrer, wherein the stirrer is fixed arranged between a liquid outlet pipe and a confluence pipe; the liquid proportioning mixer comprises the confluence pipe, wherein the confluence pipe is in a "Y"-shaped branch structure; branch pipes are symmetrically arranged at the upper end of the confluence pipe; each branch pipe is fixedwith a bypass valve used for adjusting negative pressure; a first flow meter and a second flow meter are symmetrically arranged on the upper part of the confluence pipe; positions, away from the first flow meter and the second flow meter, of the upper ends of branches of the confluence pipe are respectively and fixedly provided with a first electromagnetic valve and a second electromagnetic valve. According to the invention, through the arrangement of the flow meters, the electromagnetic valves and a center control unit, the proportion of needed mixed liquid can be accurately controlled, andprecision is high; through the arrangement of a proportion control device, on one hand, liquid mixing with a fixed proportion can be carried out rapidly, on the other hand, liquid mixing with a self-defined proportion also can be carried out, the automation degree is high, and the application range is wide.
Owner:ANHUI QIANYI INTELLIGENT EQUIP CO LTD

Janus liquid drop having structural color and based on 3D liquid drop printing, and preparation method of Janus liquid drop

The invention discloses a Janus liquid drop having structural color and based on 3D liquid drop printing, and a preparation method of the Janus liquid drop. A hydrogel with a shear thinning property is used as a matrix, two oil phases which are mutually soluble at high temperature and separatable at low temperature are used as dispersion phases, an injection pump is controlled by a 3D printer, thedispersion phases with high temperature are injected into the matrix to form liquid drops, and the two oil phases are induced to be separated by reducing the temperature so as to the form Janus liquid drops. Due to the fact that the two oil phases have different refractive indexes, incident light can form interference between interfaces, and an annular structural color is shown. The structural colors of the Janus liquid drops can be adjusted through the type or proportion of a non-ionic surfactant in the hydrogel, the positions and sizes of the Janus liquid drops can be accurately controlledthrough 3D printing, color patterns composed of the Janus liquid drops are generated, and high application value is achieved in the fields of function display, sensing and the like.
Owner:ZHEJIANG UNIV

Trichlorosilane vaporization device

The invention relates to a polysilicon production device, in particular to a trichlorosilane vaporization device, and belongs to the technical field of polysilicon production. The trichlorosilane vaporization device of the present invention comprises an evaporator, a hydrogen delivery pipe, a trichlorosilane liquid delivery pipe, a trichlorosilane gas delivery pipe, a mixed gas delivery pipe, and a mixer, and the lower end of the evaporator is provided with trichlorosilane The silicon liquid inlet and the upper end are provided with a trichlorosilane gas outlet; the trichlorosilane liquid inlet is connected with the trichlorosilane liquid conveying pipe; the trichlorosilane liquid conveying pipe and the hydrogen conveying pipe are provided with a meter; the mixer They are respectively connected with the hydrogen gas delivery pipe, the trichlorosilane gas delivery pipe and the mixed gas delivery pipe. Using the trichlorosilane vaporization device of the present invention to vaporize trichlorosilane can obtain a mixed gas with a stable ratio and uniform mixing; the mixing of raw materials is more uniform, which is conducive to the uniform growth of silicon rods in the reduction reaction of the reduction furnace, The appearance quality of the produced crystal grains is better.
Owner:SICHUAN XINGUANG SILICON TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More