40 results about "Pinellia pedatisecta" patented technology

The invention discloses pills for treating glaucoma and a preparation method, and belongs to the field of Chinese medicaments. Active ingredients of the pills consist of the following raw materials in parts by weight: 100 to 130 parts of lotus leaf, 90 to 120 parts of cassia seed, 75 to 95 parts of double hook, 70 to 90 parts of self-heal, 65 to 85 parts of pinellia tuber, 60 to 80 parts of motherwort fruit, 55 to 75 parts of rhizoma alismatis, 50 to 70 parts of white chrysanthemum, 45 to 65 parts of pyrrosia, 40 to 60 parts of mother of pearl, 35 to 55 parts of ligusticum, 35 to 50 parts of plantain seed, 30 to 45 parts of Baikal skullcap root, 30 to 40 parts of pipewort, 25 to 40 parts of areca nut, 20 to 35 parts of indigowoad leaf, 15 to 30 parts of rhizoma cyperi, 10 to 25 parts of fructus evodiae, 5 to 20 parts of pinellia pedatisecta schott, and 5 to 15 parts of bat dung. The formula is fine; according to the principles of liver and pulmonary tuberculosis heat and phlegm-damp function injury for initiating the glaucoma, medicaments for relieving liver heat and tonifying lung and qi are taken as monarchs, medicaments for clearing heat and eliminating phlegm are taken as ministers, and medicaments for removing damp and tonifying deficiency are taken as assistants and guides, so that the oxidation resistance of the body is improved, and the endocrine system is regulated; and through clinical verification, the pills have a good absorbing effect and high cure rate for various glaucoma diseases.

The invention relates to the technical field of chemical analysis and detection, in particular to a method for identifying whether pinellia is doped with Nanxing sativa: through liquid chromatography-mass spectrometer, specific detection ion pairs are used to detect the specific protein of Nanxing sativa. It can greatly improve the quality control level of Pinellia medicinal materials, and has a good guiding effect on the quality control of Pinellia decoction pieces and preparations containing Pinellia.

The invention belongs to the preparation of a novel gene, and more particularly relates to an aphid-resistant gene (PPA) and a preparation thereof and a protein using the aphid-resistant gene for coding. The 5' end of TCTAGAATGGCCTCCAAGCTCCTCCTC and the 3' end of CCCGGGC TACGCGGCAATTGGGCGCTT are taken as specific primers, a pinellia pedatisecta schott cDNA is taken as a template and a PCR amplification method is adopted so as to obtain the aphid-resistant gene (PPA); and the aphid-deadly protein is coded by the aphid-resistant gene (PPA). The invention solves the problem that the existing agglutinin gene with insect-resistant activity can not thoroughly inhibit the development and reproduction of insects, has aphid-deadly effect, obtains a full-length PPA gene and a plant expressed carrier constructed therefrom and lays foundation for further transforming the full-length PPA gene and the plant expressed carrier constructed therefrom into important crops such as cotton, wheat and rice to culture homoptera-insect-resistant transgenic plants; and can greatly reduce the use level of agricultural chemicals, achieve the aim of environmental protection and have great economic benefit andapplication value.

The invention relates to a medicinal extract for the treatment of the idiopathic facial palsy disease and a preparing method thereof. Drugs which can absorb clots and eliminate sputum, clear away heat and toxic materials and excite nerve are added on the basis of dispelling pathogenic wind and expelling evil factors from the muscles, adjusting ying and wei and strengthening the body resistance and eliminating pathogenic factors. The invention adopts the drugs calculated according to the proportion by weight: root kudzuvine 120 to 210 g, cassia twig 40 to 70 g, root of herbaceous peony 40 to 70 g, baikal skullcap root 40 to 70 g, human hair 40 to 70 g, frankincense 20 to 35 g, myrrh 20 to 35 g, dragon's blood resin 20 to 35 g, seed of nuxvomica poison nut 60 to 90 g, castor seed 60 to 90 g, pinellia pedatisecta schoot 35 to 45 g, gastrodia tuber 40 to 70 g, dried body of scorpion 40 to 70 g and fired pangolin scales 20 to 35 g; and supplementary materials as follows: litharge 952 to 1597 g, powder spice 40 to 70 g, bean oil 1270 to 2130 ml and sesame oil 635 to 1065 ml, the drugs and the supplementary materials are decocted into the medicinal extract, and two pastes are simultaneously pasted on the shangguan point and the mandible point of a patient. With remarkable therapeutic effects, high curative ratio, less side effects, and short effect time, the medicinal extract is low in cost and is applicable to the old and the young men with less contraindication and the normal working is not influenced due to the convenient usage. The preparing method is simple and easy to be mastered and operated.

The present invention discloses a metaplexis japonica essence qi supplementing and benefiting milky tea and a production method thereof. The milky tea consists of the following raw materials: metaplexis japonica, pine nuts, radix glehniae, walnut kernels, saarcodon imbricatum, radish seeds, haws, fructus aurantii immaturus, fructus galangae, milky tea powder, spices, etc. The milky tea is prepared by material selecting, drying, boiling, milling, mixing, sterilizing, and packaging. The active ingredients in the traditional Chinese medicines are boiled into an extract, the extract is prepared into powder, the powder is combined with milky tea, and the nutrients in the traditional Chinese medicines are effectively retained. Through a scientific ratio, the products have efficacies of nourishing body, supplementing body without dryness, being reasonable in nutrition structure, and enhancing human body constitution. The milky tea is health-care, can supplement essence qi, and is pure natural, non-polluting, fragrant and mellow in tastes, free of toxic or side effects, etc.