Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

40 results about "Pinellia pedatisecta" patented technology

Medicine for curing epilepsy

A medicine for treating epilepsy is disclosed in the present invention, comprising following weight amount raw materials to prepare: acorus gramineus 50 to 60, polygala root 50 to 60, curcuma 200 to 260, alum 100 to 140, vermilion 50 to 60, calcined dens draconis 60 to 70, pinellia pedatisecta 60 to 70, cicada slough 30 to 40, jujube kernel 50 to 60, gastrodia tuber 50 to 60, muscardine silkworm 60 to 70, scorpion 15 to 20. The preparation method of the medicine is also disclosed in the present invention. The medicine of the present invention can treat epilepsy, has advantages of short time medicine taking, less dosage, better curative effect and without side effect.
Owner:吴家平

Method for discriminating adulteration of Pinellia pedatisecta in pinellia tuber

ActiveCN106404961AEffectively monitor qualityMonitor qualityComponent separationCurative effectMedicine use
The invention discloses a method for discriminating adulteration of fake Pinellia pedatisecta in pinellia tuber. The method comprises the following steps: 1, preparing a sample solution; 2, detecting the sample solution; and 3, discriminating the solution. A test result proves that the method allows the peaks of pinellia tuber and Pinellia pedatisecta to be effectively separated through screening an extraction technology and a high performance liquid chromatography technology, and an appropriate characteristic discriminating peak for discriminating Pinellia pedatisecta from pinellia tuber is found, so the method can be used for discriminating pinellia tuber and Pinellia pedatisecta or processing products thereof, and also can be used for discriminating adulteration of Pinellia pedatisecta or a processing product in pinellia tuber. The method is stable, reliable, simple and fast, can effectively monitor the quality of the pinellia tuber medicinal material, guarantees the curative effect and the medicine use safety of the pinellia tuber, and has wide market application prospect.
Owner:CHENGDU UNIV OF TRADITIONAL CHINESE MEDICINE

Pedate pinellia peach seed nougat and preparation method thereof

The invention discloses pedate pinellia peach seed nougat and a preparation method thereof. The nougat is prepared from the raw materials of, by weight: 60-70 parts of white granulated sugar, 45-55 parts of maltose, 15-20 parts of peach seed, 3-5 parts of spirulina powder, 15-20 parts of milk powder, 4-8 parts of butter, 5-10 parts of dried protein, 0.5-1 parts of vanillin, 1.5-2.5 parts of edible salt, 5-7 part of dried pedate pinellia fungus, 2-3 parts of broadbean leaf, 2-3 parts of tea root, 1-2 parts of honeysuckle flower, 2-3 parts of aster panduratus, and 1-3 parts of chestnut shell. According to the invention, pedate pinellia powder is added, such that nougats with different flavors are produced. Nougat variety is increased, and nougat nutritional health-care value is improved. The produced nougat is sweet, not greasy, crispy, delicious, and chewy, and has the characteristics of sweet taste, low sugar, teeth-sticking prevention, and the like. The nougat is a green, natural, nutritious, and healthy featured snack suitable for all populations.
Owner:孙玉臣

Method for identifying whether pinelliapedatisecta exists in pinelliaternata

The invention relates to the technical field of chemical analysis and detection, and particularly relates to a method for identifying whether pinelliapedatisecta exists in pinelliaternata. The methodcomprises the following step of detecting the specific protein of the pinelliapedatisectaby liquid chromatography-mass spectrometry and using specific detection ions. The invention can greatly improvethe quality control level of the pinelliaternata, and has a good guiding effect on the quality control of the pinelliaternata and the preparations containing the pinelliaternata. The method can alsobe used for medicinal material quality control of the pinelliapedatisecta.
Owner:SHANDONG INST FOR FOOD & DRUG CONTROL

Paste for curing idiopathic facial nerve paralysis disease and preparation method thereof

The invention relates to a medicinal extract for the treatment of the idiopathic facial palsy disease and a preparing method thereof. Drugs which can absorb clots and eliminate sputum, clear away heat and toxic materials and excite nerve are added on the basis of dispelling pathogenic wind and expelling evil factors from the muscles, adjusting ying and wei and strengthening the body resistance and eliminating pathogenic factors. The invention adopts the drugs calculated according to the proportion by weight: root kudzuvine 120 to 210 g, cassia twig 40 to 70 g, root of herbaceous peony 40 to 70 g, baikal skullcap root 40 to 70 g, human hair 40 to 70 g, frankincense 20 to 35 g, myrrh 20 to 35 g, dragon's blood resin 20 to 35 g, seed of nuxvomica poison nut 60 to 90 g, castor seed 60 to 90 g, pinellia pedatisecta schoot 35 to 45 g, gastrodia tuber 40 to 70 g, dried body of scorpion 40 to 70 g and fired pangolin scales 20 to 35 g; and supplementary materials as follows: litharge 952 to 1597 g, powder spice 40 to 70 g, bean oil 1270 to 2130 ml and sesame oil 635 to 1065 ml, the drugs and the supplementary materials are decocted into the medicinal extract, and two pastes are simultaneously pasted on the shangguan point and the mandible point of a patient. With remarkable therapeutic effects, high curative ratio, less side effects, and short effect time, the medicinal extract is low in cost and is applicable to the old and the young men with less contraindication and the normal working is not influenced due to the convenient usage. The preparing method is simple and easy to be mastered and operated.
Owner:张兴茂

Buccal granules for chronic pharyngolaryngitis and preparation method

The invention discloses buccal granules for chronic pharyngolaryngitis and a preparation method, and belongs to the field of Chinese medicaments. The active ingredients of the buccal granules comprise the following raw materials in parts by weight: 50 to 70 parts of dwarf lilyturf tuber, 50 to 65 parts of rehmannia root, 45 to 60 parts of prepared rehmannia root, 45 to 60 parts of root-bark of tree peony, 40 to 55 parts of platycodon grandiflorum, 40 to 50 parts of licorice, 40 to 50 parts of root of straight ladybell, 35 to 45 parts of blackberry lily, 35 to 45 parts of white peony root, 30 to 40 parts of red peony root, 25 to 40 parts of dendrobium, 20 to 30 parts of glossy privet fruit, 20 to 30 parts of pinellia pedatisecta schott, 15 to 30 parts of loquat leaf, 15 to 25 parts of typha, 10 to 25 parts of cicada slough, 10 to 20 parts of prelude, 10 to 20 parts of dark plum, 10 to 20 parts of cynanchum atratum, and 5 to 18 parts of almond. The medicinal materials are selected according to the principle of monarch, minister, assistant and guide; diseases are treated by proper medicaments; and the buccal granules have the effects of nourishing yin, clearing heat, moistening lung and clearing away the heart fire, have a good absorption effect and a remarkable treatment effect, do not have toxic or side effect or clinical adverse response, and are high in cure rate of the chronic pharyngolaryngitis by clinical verification.
Owner:孟建国

Pinellia pedatisecta trypsin inhibitor gene, protein encoded thereby, and anti-insect application thereof

The invention discloses a pinellia pedatisecta trypsin inhibitor gene, a protein encoded thereby, and an anti-insect application thereof, wherein the nucleotide sequence table of the gene is represented as the SEQ ID No.1; during culturing an insect-resistant transgenic plant, firstly a recombinant expression vector containing the gene represented as the SEQ ID No.1 is constructed; then a transformant is constructed by means of the recombinant expression vector; finally the transformant is used for converting a target plant; positive plants then are screened; and through three generations of screening, a homozygous transgenic plant, having insect resistance relative to normal plant, can be produced. In the invention, by means of large quantity of scientific research, it is proved that thegene has significant improvement effect on insect resistance of plants and has a tight relationship with the insect resistance of plants. On the basis of the fact, the transgenic plant having high insect resistance can be prepared through a gene engineering method in the prior art. The gene has great practical significance for reducing use amount of pesticides, preventing and treating aphid and increasing planting efficiency and yield of the crops.
Owner:河北省农林科学院

Method for eliminating viruses of pinellia pedatisecta

The invention belongs to a method for eliminating viruses of crops, and in particular relates to a method for eliminating viruses of pinellia pedatisecta. The method comprises the steps of low-temperature treatment, high-temperature treatment, disinfection treatment, bulblet cutting for culture, callus culture or induction, rooting culture, secondary virus elimination, virus detection to obtain virus-free raw seedlings, tissue culture, propagation expansion, acclimatization and transplanting to obtain virus-free pinellia pedatisecta seedlings. The method solves the technical problem of eliminating viruses of the pinellia pedatisecta, can provide the virus-free pinellia pedatisecta seedlings for production, and has the advantages that the principle is utilized appropriately, the method is easy to implement, the large-area pinellia pedatisecta can be effectively planted manually, the yield of the pinellia pedatisecta can be increased, the quality of the pinellia pedatisecta can be further ensured and the like.
Owner:谢晓亮

High-yield culture method of interplanting pinellia ternate in peach garden

The invention relates to a high-yield culture method of interplanting pinellia ternate in a peach garden. The method includes the steps of selecting the peach garden, selecting pinellia ternate tubers, conducting deep plowing, applying fertilizer, conducting watering and digging and the like. Empty areas between peach trees are sufficiently used, land resources are saved, the fertilizer and water resources in the pinellia ternate planting process are used, the nutrient requirements in the peach tree growth process can be guaranteed without independent fertilizer and water nutrients, the yield of peaches is improved, the morbidity of tan disease and rotten disease in the peach planting process is reduced, and meanwhile the yield of pinellia ternate is greatly improved.
Owner:陈峰

Medicine for treating venereophobia and application of medicine

The invention provides a medicine for treating venereophobia, and the medicine is quick in effectiveness and high in curative effect and curative ratio. The scheme includes that the medicine for treating the venereophobia is prepared with raw materials including, by weight, 5-15 grams of dried orange peel, 5-15 grams of Pinellia ternate, 5-15 grams of Pinellia pedatisecta schott, 9-18 grams of Poria cocos, 10-20 grams of liquorice, 9-17 grams of bamboo shavings, 5-15 grams of immature bitter orange, 5-15 grams of polygala, 10-20 grams of date kernels and 25-35 grams of mother pearl. The raw materials of the medicine for treating the venereophobia are prepared into decoction, pills, tablets, capsules, oral liquid or granules by the aid of conventional auxiliary materials according to a conventional process. The medicine has the advantages of functions of clearing away the heart fire, reducing phlegm, soothing the liver, relieving depression, relaxing the mind, calming the nerves, dredging channels, activating blood circulation, tranquilizing and allaying excitement and inducing resuscitation, and capabilities of preventing and treating the venereophobia.
Owner:张志远

Blood circulation promoting and blood stasis removing wine

The invention discloses blood circulation promoting and blood stasis removing wine. The blood circulation promoting and blood stasis removing wine is prepared by soaking Chinese herbal medicines in wine, wherein the Chinese herbal medicines comprise 20-40 parts of angelica sinensis, 20-40 parts of teasel, 20-40 parts of lumbricus, 20-40 parts of ligusticum wallichii, 20-40 parts of sangusis draconis, 20-40 parts of radix notoginseng, 10-30 parts of monkshood, 10-30 parts of salviae miltiorrhizae, 10-30 parts of homalomena occulta, 10-30 parts of gastrodia elata, 10-30 parts of radix aconiti agrestis, 10-30 parts of radix angelicae pubescentis, 10-30 parts of radix aconite, 5-15 parts of hematoxylon, 5-15 parts of bletilla striata, 5-15 parts of radix sileris, 5-15 parts of pinellia pedatisecta schott, 5-15 parts of radix puerariae, 5-15 parts of safflower, 5-15 parts of corydalis tuber, 5-15 parts of dalbergia odorifera and 5-15 parts of camphor in parts by weight. The various natural Chinese herbal medicines are used as raw materials and are wide in source; the blood circulation promoting and blood stasis removing wine has the effects of promoting blood circulation, removing blood stasis and relieving swelling and pain, has a good curative effect and no toxic or side effects, is convenient to use and low in cost and quickly takes effects.
Owner:高鑫

Method for detecting adulteration of pinellia pedatisecta Schott in pinellia ternata

The invention discloses a method for detecting adulteration of pinellia pedatisecta Schott in pinellia ternate. The method adopts an efficient liquid chromatography for detection. The method overcomesthe problem that experimental result judgment is affected by chromatographic peaks which are consistent with retention time of a triglochinic acid reference product in an HPLC map of partial pinelliaternata sample. The detecting method has the advantages of high specificity, good precision, good repeatability and high precision, and can be used for identifying adulteration of pinellia pedatisecta Schott in pinellia ternata precisely.
Owner:CHENGDU UNIV OF TRADITIONAL CHINESE MEDICINE

Vaginal dilation suppository for cervical cancer as well as preparation method and detection method thereof

The invention relates to a vaginal dilation suppository for cervical cancer as well as a preparation method and a detection method thereof. The vaginal dilation suppository comprises a Chinese medicine extract, a matrix and a dilation carrier, wherein a medicine-containing matrix formed by the Chinese medicine extract and the matrix is coated on the surface of the dilation carrier; the Chinese medicine extract comprises pinellia pedatisecta, centella and snake gourd fruit; the medicine-containing matrix also comprises powdered cellulose which can improve the stability of the vaginal dilation suppository for cervical cancer; cinnamyl alcohol and stearoyl hexadecanamide can synergistically promote the absorption of the Chinese medicine extract, and the bioavailability of the dilation suppository is improved; in addition, the vaginal dilation suppository for cervical cancer adopts six unique technologies and has the beneficial effects of preventing outflow of medicine liquor and preventing secondary infection, and is high in stability, durable in curative effect and the like.
Owner:哈尔滨田美药业股份有限公司

PPA-linker-Thanatin fusion protein and preparation method thereof

The invention discloses a PPA-linker-thanatin fusion protein of which the amino acid sequence is as shown in SEQ ID NO: 2. The invention also discloses a preparation method of the PPA-linker-thanatin fusion protein, comprising the following steps of: acquiring target genes of recombinant pinellia pedatisecta schott agglutinin and thanatin by a two-step PCR (Polymerase Chain Reaction) method, cloning the target genes onto an E.coli expression vector pET-28a-c(+), and acquiring the expressed protein by IPTG (isopropyl thiogalactoside) induction, wherein the expressed protein is the PPA-linker-thanatin fusion protein, namely the expression product of the pinellia pedatisecta schott agglutinin-thanatin. The expression product of the pinellia pedatisecta schott agglutinin-thanatin has biological activity and has inhibiting effect on the growth of tumor cells.
Owner:ZHEJIANG SCI-TECH UNIV

Traditional Chinese medicine prescription for bone diseases

The invention discloses a traditional Chinese medicine prescription for bone diseases. The traditional Chinese medicine prescription comprises the following raw materials in parts by weight: 50 partsof radix aconiti, 100 parts of mint, 50 parts of myrrh, 50 parts of pinellia ternate, 30 parts of plantain herb, 50 parts of radix aconiti agrestis, 30 parts of arisaema consanguineum schott, 50 partsof gardenia jasminoides, 60 parts of rhizoma cyrtomii, 40 parts of asarum, 40 parts of spina gleditsiae, 60 parts of garter snakes, 30 parts of caulis spatholobi, 50 parts of dried ginger, 50 parts of leeches, 30 parts of radix angelicae pubescentis, 50 parts of rhizoma seu radix notopterygii, 50 parts of cortex cinnamomi, 60 parts of pedate pinellia, 30 parts of ground beeltle, 100 parts of lycopodium clavatum, 60 parts of cassia twig, 20 parts of liquorice, 50 parts of galangal, 50 parts of ephedra, 30 parts of semen brassicae, 50 parts of glabrous sarcandra herb and 30 parts of tripterygium wilfordii. The traditional Chinese medicine prescription for the bone diseases provided by the invention has the effects of expelling cold evil, promoting blood circulation to remove blood stasis, dredging collaterals, warming channels and expelling cold, can quickly reach a focus, accelerate blood circulation, promote metabolism and achieve the effect of relieving pain, has good treatment effects on periosteum, sclerotin, damaged articular cartilage and the like, and can recover the flexibility of joints.
Owner:江苏骨芝堂生物科技有限公司

Pills for treating glaucoma and preparation method

The invention discloses pills for treating glaucoma and a preparation method, and belongs to the field of Chinese medicaments. Active ingredients of the pills consist of the following raw materials in parts by weight: 100 to 130 parts of lotus leaf, 90 to 120 parts of cassia seed, 75 to 95 parts of double hook, 70 to 90 parts of self-heal, 65 to 85 parts of pinellia tuber, 60 to 80 parts of motherwort fruit, 55 to 75 parts of rhizoma alismatis, 50 to 70 parts of white chrysanthemum, 45 to 65 parts of pyrrosia, 40 to 60 parts of mother of pearl, 35 to 55 parts of ligusticum, 35 to 50 parts of plantain seed, 30 to 45 parts of Baikal skullcap root, 30 to 40 parts of pipewort, 25 to 40 parts of areca nut, 20 to 35 parts of indigowoad leaf, 15 to 30 parts of rhizoma cyperi, 10 to 25 parts of fructus evodiae, 5 to 20 parts of pinellia pedatisecta schott, and 5 to 15 parts of bat dung. The formula is fine; according to the principles of liver and pulmonary tuberculosis heat and phlegm-damp function injury for initiating the glaucoma, medicaments for relieving liver heat and tonifying lung and qi are taken as monarchs, medicaments for clearing heat and eliminating phlegm are taken as ministers, and medicaments for removing damp and tonifying deficiency are taken as assistants and guides, so that the oxidation resistance of the body is improved, and the endocrine system is regulated; and through clinical verification, the pills have a good absorbing effect and high cure rate for various glaucoma diseases.
Owner:刘顺慧

Method for identifying traditional Chinese medicinal material rhizome pinelliae and easily-confused products thereof

The invention relates to a method for identifying traditional Chinese medicinal material rhizome pinelliae and an easily-confused product thereof. The method comprises the following steps: (1) DNA ofa to-be-identified sample is extracted; (2) primary PCR amplification is conducted, specifically, the DNA extracted in the step (1) is taken as a template, and PCR amplification is conducted by usingan ITS 4 / 5 universal primer pair; (3) secondary PCR amplification is conducted, specifically, a PCR product obtained in the step (2) is taken as a template, PCR amplification is conducted by using a multi-site specific PCR primer pair; and (4) electrophoresis is conducted on a PCR amplification product obtained in the step (3), the to-be-identified sample with the detected 620bp band is identifiedas rhizome pinelliae, the to-be-identified sample with the detected 346bp band is identified as pinellia pedatisecta schott, the to-be-identified sample with the detected 167bp band is identified aswhipformed typhonium rhizome, and other easily-confused products are identified that no amplification band exists.
Owner:河北省中药材质量检验检测研究中心有限公司

Instant chrysanthemum and fresh bamboo leaf porridge with function of clearing away internal heat and preparation method thereof

The invention discloses an instant chrysanthemum and fresh bamboo leaf porridge with a function of clearing away internal heat. The instant chrysanthemum and fresh bamboo leaf porridge is characterized by being prepared from the following raw materials in parts by weight: 185-200 parts of sticky rice, 11-12 parts of fresh bamboo leaves, 7-8 parts of wild Chinese magnoliavine fruits, 9-10 parts of gynura segetum, 7-8 parts of muskmelon, 3-4 parts of tea-seed oil, 2-3 parts of old ginger piece, 5-6 parts of sparrow meat, 9-11 parts of filbert, 8-9 parts of dried pedate pinellia, 7-8 parts of gourd seed powder, 7-9 parts of bean curd, 2-3 parts of chrysanthemum, 0.8-1 part of Chinese wolfberry fruit, 0.9-1.1 part of finelydivided phtheirospermum root, 1.3-1.5 parts of rhizoma anemarrhenae, 1.3-1.4 parts of hemp-leaved vitex root, 9-10 parts of a nutrition additive solution and a defined amount of salt and water. Raw materials of the instant chrysanthemum and fresh bamboo leaf porridge contain multiple raw materials with a function of decreasing internal heat and clearing away internal heat, and also comprise fresh bamboo leaves, sparrow meat, chrysanthemum and the like; in addition, multiple raw materials are matched and processed, so that the instant chrysanthemum and fresh bamboo leaf porridge disclosed by the invention is rich in nutrients, is suitable for being eaten for a long time, and has a certain health-preserving effect when being eaten for a long time; in addition, the instant chrysanthemum and fresh bamboo leaf porridge disclosed by the invention is suitable for multiple crowds, and is eaten without causing nutrient disequilibrium.
Owner:郭峰

Anti-aphides gene PPA, preparation thereof and protein encoded thereby

InactiveCN101497885BReduce usageStrong lethal action against aphidsPlant peptidesInsecticidesBiotechnologyHomoptera
The invention belongs to the preparation of a novel gene, and more particularly relates to an aphid-resistant gene (PPA) and a preparation thereof and a protein using the aphid-resistant gene for coding. The 5' end of TCTAGAATGGCCTCCAAGCTCCTCCTC and the 3' end of CCCGGGC TACGCGGCAATTGGGCGCTT are taken as specific primers, a pinellia pedatisecta schott cDNA is taken as a template and a PCR amplification method is adopted so as to obtain the aphid-resistant gene (PPA); and the aphid-deadly protein is coded by the aphid-resistant gene (PPA). The invention solves the problem that the existing agglutinin gene with insect-resistant activity can not thoroughly inhibit the development and reproduction of insects, has aphid-deadly effect, obtains a full-length PPA gene and a plant expressed carrier constructed therefrom and lays foundation for further transforming the full-length PPA gene and the plant expressed carrier constructed therefrom into important crops such as cotton, wheat and rice to culture homoptera-insect-resistant transgenic plants; and can greatly reduce the use level of agricultural chemicals, achieve the aim of environmental protection and have great economic benefit andapplication value.
Owner:河北省农林科学院经济作物研究所

Paste for curing idiopathic facial nerve paralysis disease and preparation method thereof

The invention relates to a medicinal extract for the treatment of the idiopathic facial palsy disease and a preparing method thereof. Drugs which can absorb clots and eliminate sputum, clear away heat and toxic materials and excite nerve are added on the basis of dispelling pathogenic wind and expelling evil factors from the muscles, adjusting ying and wei and strengthening the body resistance and eliminating pathogenic factors. The invention adopts the drugs calculated according to the proportion by weight: root kudzuvine 120 to 210 g, cassia twig 40 to 70 g, root of herbaceous peony 40 to 70 g, baikal skullcap root 40 to 70 g, human hair 40 to 70 g, frankincense 20 to 35 g, myrrh 20 to 35 g, dragon's blood resin 20 to 35 g, seed of nuxvomica poison nut 60 to 90 g, castor seed 60 to 90 g, pinellia pedatisecta schoot 35 to 45 g, gastrodia tuber 40 to 70 g, dried body of scorpion 40 to 70 g and fired pangolin scales 20 to 35 g; and supplementary materials as follows: litharge 952 to 1597 g, powder spice 40 to 70 g, bean oil 1270 to 2130 ml and sesame oil 635 to 1065 ml, the drugs and the supplementary materials are decocted into the medicinal extract, and two pastes are simultaneously pasted on the shangguan point and the mandible point of a patient. With remarkable therapeutic effects, high curative ratio, less side effects, and short effect time, the medicinal extract is low in cost and is applicable to the old and the young men with less contraindication and the normal working is not influenced due to the convenient usage. The preparing method is simple and easy to be mastered and operated.
Owner:张兴茂

A method for identifying adulterated tiger palms in pinellia

ActiveCN106404961BEffectively monitor qualityMonitor qualityComponent separationBiotechnologyMedicinal herbs
The invention discloses a method for discriminating adulteration of fake Pinellia pedatisecta in pinellia tuber. The method comprises the following steps: 1, preparing a sample solution; 2, detecting the sample solution; and 3, discriminating the solution. A test result proves that the method allows the peaks of pinellia tuber and Pinellia pedatisecta to be effectively separated through screening an extraction technology and a high performance liquid chromatography technology, and an appropriate characteristic discriminating peak for discriminating Pinellia pedatisecta from pinellia tuber is found, so the method can be used for discriminating pinellia tuber and Pinellia pedatisecta or processing products thereof, and also can be used for discriminating adulteration of Pinellia pedatisecta or a processing product in pinellia tuber. The method is stable, reliable, simple and fast, can effectively monitor the quality of the pinellia tuber medicinal material, guarantees the curative effect and the medicine use safety of the pinellia tuber, and has wide market application prospect.
Owner:CHENGDU UNIV OF TRADITIONAL CHINESE MEDICINE

A composition with anti-fatigue and aphrodisiac functions and its preparation method

The invention provides a composition with anti-fatigue and aphrodisiac functions and a preparation method, which is composed of black tiger palm fungus powder and black truffle fungus powder; the composition has the effects of improving exercise endurance, relieving fatigue, anti-oxidation, and nourishing kidney and strengthening yang. It has been proved by animal experiments and clinical practice that it has good anti-fatigue and aphrodisiac effects. According to the theory of compatibility of traditional Chinese medicine and the theory of combination of traditional Chinese and western medicine, the present invention prepares a compound preparation, uses black tiger palm and black truffle as main raw materials, and the two synergistically exert remarkable functional activity, greatly reduces the cost of raw materials, and is beneficial to industrialized production.
Owner:JILIN UNIV

Buccal granules for chronic pharyngolaryngitis and preparation method

The invention discloses buccal granules for chronic pharyngolaryngitis and a preparation method, and belongs to the field of Chinese medicaments. The active ingredients of the buccal granules comprise the following raw materials in parts by weight: 50 to 70 parts of dwarf lilyturf tuber, 50 to 65 parts of rehmannia root, 45 to 60 parts of prepared rehmannia root, 45 to 60 parts of root-bark of tree peony, 40 to 55 parts of platycodon grandiflorum, 40 to 50 parts of licorice, 40 to 50 parts of root of straight ladybell, 35 to 45 parts of blackberry lily, 35 to 45 parts of white peony root, 30 to 40 parts of red peony root, 25 to 40 parts of dendrobium, 20 to 30 parts of glossy privet fruit, 20 to 30 parts of pinellia pedatisecta schott, 15 to 30 parts of loquat leaf, 15 to 25 parts of typha, 10 to 25 parts of cicada slough, 10 to 20 parts of prelude, 10 to 20 parts of dark plum, 10 to 20 parts of cynanchum atratum, and 5 to 18 parts of almond. The medicinal materials are selected according to the principle of monarch, minister, assistant and guide; diseases are treated by proper medicaments; and the buccal granules have the effects of nourishing yin, clearing heat, moistening lung and clearing away the heart fire, have a good absorption effect and a remarkable treatment effect, do not have toxic or side effect or clinical adverse response, and are high in cure rate of the chronic pharyngolaryngitis by clinical verification.
Owner:孟建国

Externally used traditional Chinese medicine composition for treating hyperostosis

The invention relates to an externally used traditional Chinese medicine composition for treating hyperostosis. The externally used traditional Chinese medicine composition is composed of the following pharmaceutical raw materials by weight: 30g of garden balsam stem, 15g of mole cricket, 15g of flos Rhododendri Mollis, 20g of black bone, 15g of corydalis tuber, 30g of red flower, 25g of turmeric, 35g of loranthus parasiticus, 35g of radix clematidis, 35g of astragalus membranaceus, 25g of gardenia root, 15g of rhizoma curculiginis, 15g of pinellia pedatisecta schott, 20g of ligusticum wallichii, 15g of gleditsia sinensis lam, 25g of asarum, 25g of radix angelicae pubescentis, 20g of eucommia ulmoides, 30g of pepper, 20g of buckwheat, 15g of fructus gleditsiae and 25g of notopterygium root. The externally used traditional Chinese medicine composition adopts pure natural medicines, has the effects of tonifying kidney, strengthening bone, promoting blood circulation to remove blood stasis, relieving swelling and pain, eliminating phlegm, freeing channels, dispelling wind, eliminating dampness and dispelling cold, both considers the root cause and symptoms and is accurate in curative effect and fast in action on hyperosteogeny, and the effective rate is 90%.
Owner:张志红

Black truffle kidney-tonifying formula and preparation method thereof

The invention relates to a black truffle kidney tonifying formula which comprises the following components in parts by weight: 20-30 parts of black truffle, 10-20 parts of cordyceps militaris, 1-5 parts of cinnamon, 5-10 parts of gordon euryale seeds, 1-5 parts of tricholoma matsutake, 5-10 parts of oysters, 10-15 parts of rhizoma polygonati, 1-5 parts of sarcodon aspratus, 1-5 parts of schizophyllumcommuneh, 1-5 parts of boletus aereus and 5-10 parts of poria cocos. According to the formula, the black truffle is used as the monarch to warm and tonify kidney yang, nourish liver and kidney, tonify spleen and qi and tonify yin and yang, the tricholoma matsutake, the sarcodon aspratus, the cordyceps militaris, the schizophyllumcommuneh and the boletus aereus are used as the minister to assist the black truffle to relax muscles and stimulate blood circulation, strengthen the body, balance yin and yang and reduce internal heat and soothe the nerves, and the oyster, the rhizoma polygonati, the gordon euryale seed, the cinnamon, the poria cocos and the like are used as the assistant to seek yang from yin, harmonize five internal organs, tonify kidney and warm yang. The traditional Chinese medicine is suitable for people with kidney-yang deficiency, easy fatigue, sexual function reduction and need of supplementing physical strength and energy.
Owner:北京千菌方菌物科学研究院

Chinese medicament for treating cerebrovascular diseases

The invention relates to a Chinese medicinal composition, in particular to a Chinese medicament for treating cerebrovascular diseases. The Chinese medicament comprises the following components by weight: 130 to 170 g of root of red-rooted salvia, 80 to 100 g of ginseng, 90 to 110 g of safflower, 50 to 70 g of Szechuan lovage rhizome, 260 to 340 g of pangolin, 14 to 16 pieces of long-noded pit viper, 50 to 70 g of milkwort, 50 to 70 g of mulberry twig, 40 to 60 g of cyathula root, 50 to 70 g of myrrh, 40 to 60 g of costus root, 130 to 170 g of prepared tuber of multiflower knotweed, 90 to 110 g of storax, 40 to 60 g of teasel root, 90 to 110 g of prepared pinellia pedatisecta schott, 90 to 110 g of scorpion, 40 to 60 g of white stiff silkworm, and 40 to 50 g of earthworm. The Chinese medicament is remarkable in curative effect, quick in response and good in exertion, treats both symptoms and root causes, reduces adverse reactions, is safe and reliable, has good effects of removing blood stasis, engendering new blood, cooling blood and easing joint movement, and is easy to prepare.
Owner:孟宪周 +1

LAMP detection primer group for identifying pinellia ternata and adulterants thereof and kit and application thereof

The invention discloses a LAMP detection primer group for identifying pinellia ternate and adulterants thereof and a kit and an application thereof. A LAMP detection method is used for identifying pinellia ternata and the adulterants of pinellia ternata for the first time, the sensitivity is high, the specificity is high, the selected ITS2 sequence has good species identification capacity, and only authentic pinellia ternata can be subjected to an amplification reaction. The identification range is not limited to pinellia pedatisecta, pinellia cordata and rhizoma typhonii flagelliformis in thepatent, and other plants such as pedate pinellia, typhonium giganteum, pinellia cordata, Arisaema erubescens and the like can be identified.
Owner:THE AFFILIATED HOSPITAL OF QINGDAO UNIV

Metaplexis japonica essence qi supplementing and benefiting milky tea and production method thereof

The present invention discloses a metaplexis japonica essence qi supplementing and benefiting milky tea and a production method thereof. The milky tea consists of the following raw materials: metaplexis japonica, pine nuts, radix glehniae, walnut kernels, saarcodon imbricatum, radish seeds, haws, fructus aurantii immaturus, fructus galangae, milky tea powder, spices, etc. The milky tea is prepared by material selecting, drying, boiling, milling, mixing, sterilizing, and packaging. The active ingredients in the traditional Chinese medicines are boiled into an extract, the extract is prepared into powder, the powder is combined with milky tea, and the nutrients in the traditional Chinese medicines are effectively retained. Through a scientific ratio, the products have efficacies of nourishing body, supplementing body without dryness, being reasonable in nutrition structure, and enhancing human body constitution. The milky tea is health-care, can supplement essence qi, and is pure natural, non-polluting, fragrant and mellow in tastes, free of toxic or side effects, etc.
Owner:HARBIN MO MEDICAL BIOLOGICAL TECH CO LTD

Topical drug for treating breast cancer and preparation method thereof

Disclosed is a topical drug for treating breast cancer and preparation method thereof. The topical drug comprises the following ingredients in parts by weight: 5-10 parts of Astragalus, 3-5 parts of Oldenlandia diffusa, 3-5 parts of dandelion, 5-10 parts of Lycoris radiate, 5-8 parts of Carapax trionycis, 3-5 parts of Pinellia pedatisecta, 2-3 parts of Acorus calamus, 3-5 parts of Ferula sinkiangensis, 3-5 parts of doubleteeth pubescent angelica root, 4-6 parts of Cryptotaenia japonica Hassk, 3-5 parts of Whitmania pigra Whitman, 5-8 parts of Wedelia chinensis, 6-8 parts of Echinacea purpurea, 4-6 parts of Folium Eriobotryae, 3-5 parts of Sedum sarmentosum, 5-10 parts of Angelicae sinensis, 2-5 parts of asparagus, 2-3 parts of scorpio, 5-8 parts of Rubia cordifolia L., 2-3 parts of alfalfa extract, 3-5 parts of extract of Jew's ear from mulberry trees, 5-7 parts of myrrh, 3-6 parts of nutgrass galingale rhizome and 3-5 parts of pericarpium citri reticulatae viride.
Owner:MA
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More