20 results about "Sclerosis skin" patented technology

An isolated nucleic acid that includes the nucleotide sequence: CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 12) is provided. In some embodiment, the nucleic acid includes at least one chemically-modified nucleotide. The nucleic acid and composition containing same find use in treating conditions associated with inflammation and / or fibrosis, for example, without limitation, heart conditions, such as hypertrophic myocardiopathy, myocardial infarction, and heart failure with preserved ejection fraction; muscle disorders, such as muscular dystrophy; skin disorders, such as scleroderma; and inflammatory conditions, such as autoimmune conditions or inflammatory conditions associated with a viral infection.

The invention provides systems and methods for diagnosing and treating an inflammatory skin disease in a patient. The described methods may be used for longitudinal monitoring of the development, progression, or regression of a skin disease including lupus, psoriasis, atopic dermatitis, and systemic sclerosis (scleroderma) condition in a patient, in response to a therapy administered for the condition.

The present invention relates to novel heterocyclic compounds useful in the preparation of medicaments for the treatment of diseases associated with various functions of the histamine 4 receptor.In particular, said drugs are useful for treating inflammatory diseases, allergy, pain, nasal polyps, rhinitis, chronic sinusitis, nasal congestion, nasal itching, asthma, chronic obstructive pulmonary disease, rheumatoid arthritis, atopic dermatitis, psoriasis, eczema, pruritus, itchy skin, urticaria, idiopathic chronic urticaria, scleroderma, conjunctivitis, keratoconjunctivitis, ocular inflammation, dry eye, cardiac dysfunction, arrhythmia, atherosclerosis, multiple sclerosis, inflammatory bowel disease (including colitis, Crohn's disease, ulcerative colitis), inflammatory pain, neuropathic pain, osteoarthritis pain, autoimmune disease, thyroid, immune-mediated (also known as type I) diabetes, lupus, post-surgical adhesions, vestibular disorders and cancer.

The present application belongs to the technical field of dermatosis treatment products, and particularly relates to a soft pelleted medicine and a preparation method thereof. The soft pelleted medicine is prepared from the following raw materials in parts by weight: 20-40 parts of Ramulus cinnamomi, 25-35 parts of Radix astragali, 5-15 parts of Semen persicae, 5-15 parts of Ophiopogon, 5-15 parts of Carthamus tinctorius, 15-30 parts of calcined Radix paeoniae alba, 10-20 parts of Radix angelicae sinensis, 15-30 parts of Radix rehmanniae preparata, 20-40 parts of Radix codonopsis, 5-15 parts of Radix paeoniae alba, 5-10 parts of Ephedra, 5-10 parts of Radix rubiae, 5-15 parts of Centella asiatica, 2-5 parts of Radix et Rhizoma aconiti, 5-10 parts of Salvinia natans, and 5-10 parts of Rhizoma zingiberis. The soft pelleted medicine provided by the present application has the main effects of warming yang and benefiting qi, promoting blood circulation to remove meridian obstruction, dispelling cold and dampness, removing blood stasis and promoting tissue regeneration, and is used for treating dermatosis such as scleroderma, frostbite, Raynaud's disease, skin atrophy, and the like, and particularly has remarkable effects on scleroderma, frostbite, Raynaud's disease, and skin atrophy.

This invention belongs to the technical field of skin disease treatment products, specifically relating to a topical hot compress for treating scleroderma and its preparation method. The topical hot compress for treating scleroderma is made from the following raw materials in parts by weight: 20-40 parts of Artemisia argyi, 20-40 parts of Cinnamomum cassia, 10-20 parts of Sparganium stoloniferum, 10-20 parts of Curcuma zedoaria, 10-20 parts of Loranthus parasiticus, 15-30 parts of Gynostemma pentaphyllum, 10-20 parts of Spirodela polyrhiza, 15-30 parts of Spirodela polyrhiza, 15-30 parts of Ephedra sinica, 20-40 parts of Clematis chinensis, 5-15 parts of Eupolyphaga sinensis, 15-25 parts of Eriocaulon buergerianum, 5-15 parts of Carthamus tinctorius, 3-6 parts of Dracaena cochinchinensis, 3-6 parts of processed Strychnos nux-vomica, 20-40 parts of Vaccaria segetalis, 20-40 parts of Astragalus membranaceus, 10-20 parts of Magnolia officinalis, 10-20 parts of Aconitum carmichaelii, and 22-40 parts of rice wine. This invention is a topical medication that eliminates the need for oral administration, treating the disease externally and guiding the pathogenic factors to a cure. It avoids the inconvenience of bitter medications and effectively relieves symptoms and promotes the cure of localized scleroderma.

The present disclosure relates to compounds, compositions, and methods for inhibiting Nox4 signaling. Also described are methods of treating fibrotic disorders (e.g., pulmonary fibrosis, heart fibrosis, kidney fibrosis, liver fibrosis, skin fibrosis, mediastinal fibrosis, retroperitoneal cavity fibrosis, bone marrow fibrosis, scleroderma or systemic sclerosis), acute respiratory distress syndrome (ARDS) or for treating cancer (e.g., a sarcoma, a carcinoma, a hematological cancer, a solid tumor, breast cancer, cervical cancer, gastrointestinal cancer, colorectal cancer, brain cancer, skin cancer, prostate cancer, ovarian cancer, non-small cell lung carcinoma, thyroid cancer, testicular cancer, pancreatic cancer, liver cancer, endometrial cancer, melanoma, glioma, leukemia, lymphoma, chronic myeloproliferative disorder, myelodysplastic syndrome, myeloproliferative neoplasm, plasma cell neoplasm (myeloma)) using the disclosed compounds and compositions. This abstract is intended as a scanning tool for purposes of searching in the particular art and is not intended to be limiting of the present disclosure.

Provided is a compound having an mPGES-1 inhibitory activity and useful for the prophylaxis or treatment of pain, rheumatism, osteoarthritis, fever, Alzheimer's disease, multiple sclerosis, arteriosclerosis, glaucoma, ocular hypertension, ischemic retinal disease, systemic scleroderma and cancer including colorectal cancer.A compound represented by the formula [I] or a pharmaceutically acceptable salt thereof:wherein each symbol is as defined in the SPECIFICATION.

The present disclosure finds that skin sclerosis can be ameliorated by applying an externally applied skin medicine containing sirolimus to the skin in systemic scleroderma, and thus finds a novel medicine for treating or preventing skin sclerosis in systemic scleroderma.

The invention belongs to the technical field of skin disease treatment products, and particularly relates to a soft-skin pill and a preparation method thereof. The soft skin pill is prepared from the following raw materials in parts by weight: 20-40 parts of cassia twig, 25-35 parts of astragalus membranaceus, 5-15 parts of peach kernel, 5-15 parts of garter snake, 5-15 parts of safflower, 15-30 parts of burnt white peony root, 10-20 parts of angelica sinensis, 15-30 parts of prepared rehmannia root, 20-40 parts of codonopsis pilosula, 5-15 parts of prepared radix aconiti lateralis praeparata slice, 5-10 parts of ephedra, 5-10 parts of ground beetle, 5-15 parts of centella asiatica, 2-5 parts of asarum, 5-10 parts of duckweed and 5-10 parts of dried ginger. The skin softening pill provided by the invention has the main effects of warming yang and tonifying qi, promoting blood circulation to remove meridian obstruction, dispelling cold and dampness, removing blood stasis and promoting tissue regeneration, is used for skin diseases such as scleroderma, chilblain, Raynaud's disease and skin atrophy, and particularly has a remarkable curative effect on the scleroderma, the chilblain, the Raynaud's disease and the skin atrophy.

The invention discloses an application of calycosin-7-glucoside in preparation of a medicine for treating skin fibrosis diseases. In-vitro and in-vivo experiments show that calycosin glucose can effectively inhibit proliferation of primary scleroderma cells, promote apoptosis of the primary scleroderma cells and effectively inhibit development of mouse skin fibrosis. Therefore, the calycosin-7-glucoside can be used for developing the medicine for treating the skin fibrosis diseases, and an effective way is provided for treating the skin fibrosis diseases.

The present invention discloses the application of calycosin-7-O-β-D-glucoside in the preparation of a medicament for treating skin fibrosis diseases. Through in vitro and in vivo experiments, the present invention finds that calycosin-7-O-β-D-glucoside can effectively inhibit the proliferation of primary scleroderma cells, promote the apoptosis of primary scleroderma cells, and effectively inhibit the development of skin fibrosis in mice. Therefore, calycosin-7-O-β-D-glucoside can be used to develop a medicament for treating skin fibrosis diseases, providing an effective way for the treatment of skin fibrosis diseases.

The present disclosure relates to compounds, compositions, and methods for inhibiting Nox4 signaling. Also described are methods of treating fibrotic disorders (e.g, pulmonary fibrosis, heart fibrosis, kidney fibrosis, liver fibrosis, skin fibrosis, mediastinal fibrosis, retroperitoneal cavity fibrosis, bone marrow fibrosis, scleroderma or systemic sclerosis), acute respiratory distress syndrome (ARDS), and cancer (e.g, a sarcoma, a carcinoma, a hematological cancer, a solid tumor, breast cancer, cervical cancer, gastrointestinal cancer, colorectal cancer, brain cancer, skin cancer, prostate cancer, ovarian cancer, non-small cell lung carcinoma, thyroid cancer, testicular cancer, pancreatic cancer, liver cancer, endometrial cancer, melanoma, glioma, leukemia, lymphoma, chronic myeloproliferative disorder, myelodysplastic syndrome, myeloproliferative neoplasm, plasma cell neoplasm (myeloma)) using the disclosed compounds and compositions. This abstract is intended as a scanning tool for purposes of searching in the particular art and is not intended to be limiting of the present disclosure.

The invention belongs to the technical field of medical biology, and particularly relates to Ephrin-B2 recombinant protein as well as a vaccine, a preparation method and application thereof. In order to treat and prevent fibrotic diseases, the Ephrin-B2 recombinant protein is expressed and purified based on an Ephrin-B2 extracellular fragment, and an adjuvant is added to prepare the Ephrin-B2 recombinant protein vaccine which is used for treating and preventing the fibrotic diseases. Animal experiment results show that the Ephrin-B2 recombinant protein vaccine prepared by the invention can initiate obvious cellular immune and humoral immune response in a mouse body, effectively treat and prevent idiopathic pulmonary fibrosis and radiation-induced pulmonary fibrosis, and has an obvious inhibitory effect on bleomycin-induced systemic sclerosis skin fibrosis, which can be seen that the Ephrin-B2 recombinant protein vaccine can be used as a vaccine for treating systemic sclerosis skin fibrosis. The Ephrin-B2 recombinant protein and the vaccine thereof provided by the invention provide a candidate scheme for future research on conversion of preventive and therapeutic vaccines for fibrotic diseases.

The invention relates to a composition capable of intervening collagen fibrosis and a preparation method and application thereof.The composition comprises gallic acid or gallic acid derivatives, and when the composition is used for repairing damaged skin, fibroblast differentiation can be intervened; the composition can also comprise silicone and Ectoine, and the three components cooperate to interfere with collagen fibrosis, so that the composition can be further used for treating or preventing skin diseases such as scars, scleroderma or skin photoaging caused by collagen fibrosis.

The present application relates to the field of pharmaceutical preparations and relates to [1,2,4]triazolo [1,5-a]pyridine compounds and their isomers or pharmaceutically acceptable salts or their crystal forms, as well as local topical preparations and their applications in skin diseases. Specifically, it relates to a local topical formulations of compound (S)—N-(5-(2-(2,2-difluorocyclopropanecarbonyl)-2-nitrospiro[3.5]non-7-yl)-[1,2,4-triazole[1,5-a]pyridine-2-yl) cyclopropaneformamide and its isomers or pharmaceutically acceptable salts or crystal forms, and their applications in skin diseases. The preferred skin diseases include psoriasis, atopic dermatitis, vitiligo, lupus erythematosus, alopecia areata, eczema, contact dermatitis, urticaria, pompholyxs, dermatomyositis, scleroderma, acne, and seborrheic dermatitis.

The invention provides a topical Chinese medicinal compound essential oil for scleroderma, and relates to the technical field of topical Chinese medicinal essential oil pharmaceuticals. The invention follows the principle of TCM syndrome differentiation and treatment, and rationally combines the ingredients to form the Chinese medicinal compound essential oil with wormwood essential oil, peony bark essential oil, salvia miltiorrhiza essential oil, prickly ash essential oil, cnidium monnieri essential oil, clove essential oil, angelica essential oil, and borneol essential oil. The Chinese medicinal compound essential oil has good therapeutic effects of promoting blood circulation and removing blood stasis, warming the meridians and dispelling cold, reducing swelling and relieving pain, and clearing away heat and detoxifying.

The invention belongs to the technical field of skin disease treatment products, and particularly relates to an external hot compress agent for treating scleroderma and a preparation method of the external hot compress agent. The traditional Chinese medicine is prepared from the following raw materials in parts by weight: 20-40 parts of folium artemisiae argyi, 20-40 parts of cassia twig, 10-20 parts of rhizoma sparganii, 10-20 parts of curcuma zedoary, 10-20 parts of centella asiatica, 15-30 parts of loess-doll, 10-20 parts of duckweed, 15-30 parts of ephedra, 20-40 parts of radix clematidis, 5-15 parts of ground beetle, 15-25 parts of turmeric, 5-15 parts of safflower, 3-6 parts of dragon's blood, 3-6 parts of processed semen strychni, 20-40 parts of cowherb seed, 20-40 parts of astragalus membranaceus, 10-20 parts of mangnolia officinalis, 10-20 parts of aconite and 22-40 parts of yellow wine. The traditional Chinese medicine is an external medicine, does not need to be orally taken, treats external diseases by external treatment, is beneficial to the situation, and provides a way for curing pathogenic factors. The trouble of bitter taste of medicines is avoided, and the traditional Chinese medicine composition also has good effects of relieving symptoms of the localized scleroderma and curing the localized scleroderma.

The present invention relates to a compound of formula (I),whereinX1, X2 and X3 are, independently of each other, N or CH; with the proviso that at least two of X1, X2 and X3 are N;Y is N or CH;W is H or F; with the proviso that when W is F, then X1, X2 and X3 are N;R1 and R2 are independently of each other(i) a morpholinyl of formula (II)wherein the arrow denotes the bond in formula (I); andwherein R3 and R4 are independently of each other H, C1-C3alkyl optionally substituted with one or two OH, C1-C2fluoroalkyl, C1-C2alkoxy, C1-C2alkoxyC1-C3alkyl, CN, or C(O)O—C1-C2alkyl; or R3 and R4 form together a bivalent residue—R5R6— selected from C1-C3alkylene optionally substituted with 1 to 4 F, —CH2—O—CH2—, —CH2—NH—CH2—, or any of the structureswherein the arrows denote the bonds in formula (II); or(ii) a saturated 6-membered heterocyclic ring Z selected from thiomorpholinyl and piperazinyl, optionally substituted by 1 to 3 R7; wherein R7 is independently at each occurrence C1-C3alkyl optionally substituted with one or two OH, C1-C2fluoroalkyl, C1-C2alkoxyC1-C3alkyl, C3-C6cycloalkyl; or two R7 substituents form together a bivalent residue —R8R9— selected from C1-C3alkylene optionally substituted with 1 to 4 F, —CH2—O—CH2— or —O—CH2CH2—O—;with the proviso that at least one of R1 and R2 is a morpholinyl of formula II;and prodrugs, metabolites, tautomers, solvates and pharmaceutically acceptable salts thereof, for use in a method of treating a skin disorder in a subject, wherein said skin disorder is a genodermatosis, a vascular anomaly or a skin disorder selected from scleroderma, sclerodermatous chronic graft-versus-host disease, lichen sclerosus, lichen planus, lichen ruber planus and scars.

The present invention relates to a compound of formula (I), wherein X1, X2 and X3 are, independently of each other, N or CH; with the proviso that at least two of X1X2 and X3 are N; Y is N or CH; W is H or F; with the proviso that when W is F, then X1, X2 and X3 are N; R1 and R2 are independently of each other (i) a morpholinyl of formula (II) wherein the arrow denotes the bond in formula (I); and wherein R3 and R4 are independently of each other H, C1-C3alkyl optionally substituted with one or two OH, C1-C2fluoroalkyl, C1-C2alkoxy, C1-C2alkoxyC1-C3alkyl, CN, or C(0)0-C1-C2alkyl; or R3 and R4 form together a bivalent residue —R5R6— selected from C1-C3alkylene optionally substituted with 1 to 4 F, —CH2-0-CH2—, —CH2—NH—CH2—, or any of the structures wherein the arrows denote the bonds in formula (II); or (ii) a saturated 6-membered heterocyclic ring Z selected from thiomorpholinyl and piperazinyl, optionally substituted by 1 to 3 R7; wherein R7 is independently at each occurrence C1-C3alkyl optionally substituted with one or two OH, C1-C2fluoroalkyl, C1-C2alkoxyC1-C3alkyl, C3-C6cycloalkyl; or two R7 substituents form together a bivalent residue —R8R9— selected from C1-C3alkylene optionally substituted with 1 to 4 F, —CH2-0-CH2— or -0-CH2CH2-0- with the proviso that at least one of R1 and R2 is a morpholinyl of formula II; and prodrugs, metabolites, tautomers, solvates and pharmaceutically acceptable salts thereof, for use in a method of treating a skin disorder in a subject, wherein said skin disorder is a genodermatosis, a vascular anomaly or a skin disorder selected from scleroderma, sclerodermatous chronic graft-versus-host disease, lichen sclerosus, lichen planus, lichen ruber planus and scars.

The application belongs to the field of traditional Chinese medicine, and particularly relates to an external traditional Chinese medicine composition and application thereof in limited scleroderma. The application inherits and follows the experience of contemporary Chinese medicine experts in treating skin rheumatism, combines with clinical practice and the theory of external medicine research and development, modifies drug compatibility and dosage form, and provides a more comprehensive, effective and safe external traditional Chinese medicine preparation for limited scleroderma. The external traditional Chinese medicine preparation has the effects of warming yang and dispelling cold, promoting blood circulation and removing blood stasis, and searching for wind, resolving phlegm and dredging collaterals. The combination with internal herbal medicine achieves a synergistic effect, further enhances the curative effect on patients with limited scleroderma, improves the clinical symptoms of patients, improves the quality of life, and has good safety.