44 results about "Clausena lansium" patented technology

The invention discloses a primer for identifying authenticity of distant hybridization offspring of clausena lansium and citrus, the primer can amplify target bands of 270bp, 296bp and 235bp in the distant hybridization offspring of clausena lansium and citrus, and the hybridization offspring with the target bands of 270bp, 296bp and 235bp is the real hybridization offspring. The method provided by the invention can quickly and accurately identify the authenticity of the distant hybridization offspring of the clausena lansium and the citrus, has the characteristics of short identification time, high accuracy, strong specificity and the like, provides an effective basis for identification and research of the distant hybridization offspring of the clausena lansium and the citrus, and is beneficial to genetic improvement of citrus varieties.

The invention belongs to the field of new materials for daily use, and discloses an acne-removing composition, application and an acne-removing product, and the acne-removing composition comprises the following components by weight: 0.1-10 parts of a pseudo-ginseng extract; 0.1 to 10 parts of clausena lansium bark extract; 0.5 to 15 parts of radix sophorae flavescentis extract; and 0.1-10 parts of a lotus seed extract. According to the composition, the pseudo-ginseng extract, the clausena lansium bark extract, the radix sophorae flavescentis extract and the lotus seed extract are combined, and the mild and rapid acne removing effect is achieved.

The invention discloses a reagent for overcoming distant hybridization incompatibility of rutaceous plants by using sodium salicylate and a use method of the reagent. According to the method, a sodium salicylate solution is sprayed on stigmas of rutaceous plants, so that the incompatibility of distant hybridization of the four-season oranges and the clausena lansium is overcome. The method is small in damage to plants, remarkable in effect of overcoming the distant hybridization incompatibility and wide in application range, can be further used for overcoming the distant hybridization incompatibility of other rutaceous plants, and has important value for breeding and seed production of the rutaceous plants.

The invention discloses a reagent for overcoming distant hybridization incompatibility of rutaceous plants and a use method of the reagent. According to the method, the D-Ser solution is sprayed to the stigmas of rutaceous plants, so that the incompatibility of distant hybridization of the four-season oranges and the clausena lansium is overcome. The method is small in damage to plants, remarkable in effect of overcoming the distant hybridization incompatibility and wide in application range, can be further used for overcoming the distant hybridization incompatibility of other rutaceous plants, and has important value for breeding and seed production of the rutaceous plants.

The utility model discloses a gizzard peeling device which comprises a base, a control panel is arranged on the outer surface of one side of the base, and a sliding type detachable clausena lansium collecting device used for improving clausena lansium collecting and cleaning convenience is arranged on the outer surface of the upper end of the base. An automatic gizzard peeling device for improving the gizzard peeling convenience is arranged on the outer surface of the upper end of the sliding type detachable clausena lansium collecting device, the automatic gizzard peeling device comprises a mounting base, a mounting groove is formed in the middle of the outer surface of the upper end of the mounting base, and baffles are arranged on the inner surfaces of the two sides of the mounting groove; driving motors are fixedly mounted on the outer surfaces of the two sides of the mounting base correspondingly, and the other ends of output shafts of the driving motors are fixedly connected with rotating shafts. According to the gizzard peeling device for the chicken gizzards, the automatic gizzard peeling device is arranged, so that the gizzard peeling device is simple in structure and high in automation degree, the automatic gizzard peeling operation of the chicken gizzards can be realized, time and labor are saved, the gizzard peeling convenience is improved, and the processing efficiency is improved.

The invention belongs to the technical field of bioengineering, discloses a gene ClPHL6 for regulating and controlling the sugar content of clausena lansium fruits and application of the gene ClPHL6, and particularly discloses application of ClPHL6 in regulating and controlling the soluble sugar content of plant leaves / fruits. According to the invention, the clausena lansium ClPHL6 gene is screened for the first time, and experiments prove that the ClPHL6 gene can significantly enhance the accumulation of soluble sugar in tobacco leaves and tomato fruits. The gene can be used as a target gene for controlling the content of soluble sugar in the clausena lansium fruits and improving the flavor of the fruits for in-depth research, and has high application and research values.

The invention discloses an antioxidant coenzyme Q10 capsule and a preparation method thereof, and belongs to the field of health care products. The coenzyme Q10 capsule contains an antioxidant composition, and the composition is composed of coenzyme Q10, a humifuse euphorbia herb extract, a shaddock peel extract and a Chinese wampee fruit extract. The coenzyme Q10, the humifuse euphorbia herb extract, the shaddock peel extract and the Chinese wampee fruit extract are compounded for use and have a synergistic effect, so that an excellent anti-oxidation effect is obtained.

The utility model discloses a clausena lansium picking claw, which belongs to the technical field of fruit picking tools and comprises an adjusting rod, a picking seat is arranged at the top end of the adjusting rod, movable frames are fixedly connected to the periphery of the top end of the picking seat, and special-shaped picking plates are rotatably connected to inner cavities of the movable frames. An adjusting mechanism used for changing the angle of the special-shaped picking plate is installed on the upper surface of the picking base, the bottom end of the adjusting mechanism penetrates through the picking base and is provided with a pull rope, a plurality of sets of positioning blocks are arranged at the bottom end of the pull rope, a pull rod base is arranged at the bottom end of an adjusting rod, and a clamping groove is formed in the surface of the pull rod base; a supporting structure for supporting the pull rope is arranged at the bottom end of the pull rod seat, so that the length of the rod body can be adjusted, clausena lansium fruits of different heights can be picked, convenience is provided for picking work of the clausena lansium fruits, and the picking efficiency of the clausena lansium fruits is improved.

The invention belongs to the technical field of biological engineering, discloses a gene ClALMT12 for regulating and controlling the organic acid content of clausena lansium fruits and application of the gene ClALMT12, and particularly discloses application of ClALMT12 in regulating and controlling the organic acid content of plant leaves / fruits. According to the invention, the clausena lansium ClALMT12 gene is screened for the first time, and experiments prove that the ClALMT12 gene can significantly enhance the accumulation of organic acids in tobacco leaves and tomato fruits. The gene can be used as a target gene for regulating and controlling the organic acid content of the clausena lansium fruits and improving the flavor of the fruits for in-depth research, and has relatively high application and research values.

The utility model relates to the technical field of fruit tree planting, and discloses a clausena lansium fruit tree rapid planting device which comprises a trolley, a pedal is horizontally and fixedly connected to one end of the trolley, idler wheels are installed on the two symmetrical sides of the bottom of the trolley, two idler wheels are arranged on the trolley, and the other surface idler wheels are arranged on the pedal. A sliding column vertically slides at the bottom of the trolley, a sliding mechanism for sliding the sliding column is arranged in the trolley, a conical block is rotatably connected to the bottom of the sliding column, a threaded piece is arranged on the surface of the conical block, and a rotating mechanism for rotating the conical block is arranged in the trolley. Through the arrangement of the sliding column, when the conical block is rotated, the conical block can be driven to slide downwards at the same time, so that the conical block can be used for perforating soil at the bottom and twisting out the soil at the perforated position, and then the root of a sapling can be conveniently buried after the sapling is planted.

The invention provides a clausena lansium peel natural polyphenol composition and a preparation method thereof, and relates to the technical field of biological medicines.The preparation method comprises the steps that a target polyphenol compound standard curve is constructed through high performance liquid chromatography, the content of target polyphenol compounds in clausena lansium peel extract is analyzed and detected, and a collection time period is determined; and eluting and separating the natural polyphenol composition in the clausena lansium peel extract by using preparative liquid chromatography, and collecting eluted components within a collection time period to obtain the clausena lansium peel natural polyphenol composition. The purity of the prepared natural polyphenol composition reaches 75% or above; the target polyphenol compound components and the polyphenol compound components with unknown structures, which are not compared by using the standard substance, are ensured to be contained; compared with a clausena lansium peel extract, a part of polyphenol compound monomer and a polyphenol monomer composition before purification, the clausena lansium peel extract has better anti-inflammatory activity. The technical problem that an effective purification preparation method for the natural polyphenol composition in the clausena lansium peel is lacked in the prior art is solved.

The invention relates to the technical field of gout ointment, and particularly discloses gout adjuvant therapy ointment and a preparation method thereof.The gout adjuvant therapy ointment is prepared from, by mass, 20-30 parts of sunflower heads, 10-15 parts of lilies, 3-5 parts of Japanese chilies, 15-20 parts of clausena lansium, 8-12 parts of folium isatidis, 30-40 parts of honey and 15-20 parts of rock candy. According to the treatment ointment, natural plants such as sunflower discs, lilies, Japanese peppers, clausena lansium and folium isatidis serve as main raw materials, and compared with traditional gout treatment drugs, the treatment ointment has the advantages that the symptoms of gout are relieved, and meanwhile side effects on the body are greatly reduced. The invention provides a safer adjuvant therapy choice for gout patients, and is especially suitable for patients who cannot tolerate the side effects of traditional drugs or have poor compliance to drug treatment.

The invention belongs to the technical field of vegetable preservation, and particularly relates to a preservation method suitable for stem brassica vegetables. The stem brassica vegetables are pretreated, the composite preservative is sprayed to leaves and brassica stems, and a W / O / W emulsion formed by the composite preservative can form a transparent and flexible thin film, has good barrier property and moisture retention, can slow down the loss of moisture on the surfaces of the leaves and the surfaces of the brassica stems, remarkably reduces the respiration rate of the vegetables, and improves the quality of the brassica vegetables. The used green bacteriostatic preservative is active substances including rosemary extract, melissa extract, clausena lansium peel extract and loquat leaf extract and can effectively inhibit bacteria, beewax with a certain concentration forms a film at a cut, and nutrient substance loss and water loss are reduced; according to the invention, through the combination of spraying and soaking of different preservatives, the fresh-keeping agent has the fresh-keeping effects of moisture retention, respiration rate reduction, bacteriostasis, anti-oxidation protection and energy supply.

The invention provides a pharmaceutical composition as well as application and a medicament thereof. The pharmaceutical composition comprises 5%-85% of a gymnema sylvestre extract, 5%-85% of a balsam pear extract, 5%-85% of a turmeric extract and 5%-85% of a wood orange extract. % is the mass percentage of each component in the pharmaceutical composition. The pharmaceutical composition provides significant benefits in managing diabetes, hyperlipidemia and associated metabolic disorders.

The invention provides Hainan agar May tea and a preparation method thereof, and relates to the field of herbal tea. The traditional Chinese medicine composition is prepared by mixing the following herbaceous plants: mallotus oblongifolius, phoenix-tail fern, plantain herb, coix leaf, emilia sonchifolia, lygodium japonicum, paphiopedilum armatum, phyllostachys heterocycla, Chinese fevervine herb, tripterygium wilfordii, couch grass root, Newtonian grass, whitebackleaf mallotus root, pteris semipinnata, rhizoma calami, cassia seed, alpinia japonica leaf, water pomegranate leaf, pomegranate leaf, pigeon pea leaf, ficus simplicissima leaf, embelia laeta, flemingia philippinensis leaf, clausena lansium leaf, evodia lepta leaf and honeysuckle. The invention has the following advantages: all the raw materials are selected from deep mountains, dense forests, no pesticide and chemical fertilizer, zero additive and natural taste, the process is innovative: multi-layer drying, stir-frying and airing are carried out, the tea soup is sweet in taste, golden yellow in soup color and rich in aroma level, and the formula is upgraded: special plant resources in Hainan are fully utilized, and various herbaceous plants capable of clearing heat, diminishing inflammation, detoxifying, clearing damp and relieving summer-heat are added, so that the tea has a good health-care effect. And warm herbaceous plants are added, such as phoenix-tail fern, plantain herb, emilia sonchifolia and the like.

The invention belongs to the field of rubber tree cultivation, and particularly relates to a biocontrol bacterium preparation for preventing and treating anthracnose of rubber trees and preparation of the biocontrol bacterium preparation. The biocontrol microbial agent is prepared from the following components in parts by weight: 0.5 to 1 part of bacillus velezensis HN-2, 1 to 1.5 parts of bacillus laterosporus, 5 to 10 parts of mango polysaccharide, 20 to 40 parts of herba king grass, 10 to 20 parts of clausena lansium peel, 15 to 25 parts of pitaya stem and 8 to 12 parts of rubber leaf. According to the biocontrol microbial inoculum, waste pitaya stems in the pitaya cultivation process, waste rubber leaves in the rubber tree cultivation process and wampee peel are used for preparing an extracting solution for strain fermentation, and the biocontrol microbial inoculum has good inhibitory activity on colletotrichum gloeosporioides of the rubber trees and has good application prospects in the aspect of preventing and treating the colletotrichum gloeosporioides of the rubber trees.

The rich clausena lansium fruit powder is prepared from the following raw materials in parts by weight: 20 to 50 parts of seedless clausena lansium pulp, 20 to 50 parts of seeded clausena lansium juice, 3 to 5 parts of clausena lansium extracting solution, 10 to 25 parts of white granulated sugar, 25 to 65 parts of carrier, 0.5 to 2 parts of citric acid, 0.1 to 0.2 part of vitamin C, 0.05 to 0.2 part of sweetening agent and 0.05 to 0.1 part of preservative. The freshness and flavor concentration of the clausena lansium are reserved to the maximum extent by means of freezing and pulping, small-fire decocting of fruit pulp, supercritical extraction and continuous dynamic vacuum drying, 3.5% of the prepared clausena lansium powder is added into an ice cream product, and the clausena lansium fruit powder has the clausena lansium fruity flavor which is balanced in sourness and sweetness, smooth in taste and rich in flavor.

The quantitative irrigation cultivation frame comprises a water tank, a supporting frame is arranged at the top of the water tank, a containing groove is formed in the center of the top of the supporting frame, and a rotating motor is arranged at the center of the bottom in the containing groove. The device has the beneficial effects that through the design of the adjusting assembly, when a spray head on a certain water outlet assembly is blocked or damaged, in order to ensure that the normal operation of the water outlet assembly is not influenced by the maintenance work of the spray head, the clamping assembly can be driven by the adjusting assembly to relieve the clamping and limiting of the water outlet assembly, and meanwhile, the water outlet assembly is prevented from being damaged. The water outlet assembly is driven to rotate so that the other set of nozzles on the water outlet assembly can be rotated to the bottom of the water outlet to conduct water outlet action, the damaged nozzles can be maintained under the condition that operation of the water outlet assembly is not affected, or when batch nozzles are damaged, the same maintenance work is conducted, and loss of single maintenance work is avoided.

The invention provides a golden pomfret preservation method, which comprises: (1) preparing a preservation solution: adding tragacanth and chitosan into water, uniformly stirring and mixing, then adding a clausena lansium seed extract, a hypericum japonicum extract and a fig leaf extract, uniformly stirring and mixing, and finally adding glycerin, and uniformly stirring and mixing to obtain the preservation solution; and (2) performing fresh-keeping treatment on the golden pomfret, namely removing fish scales, gills and viscera from the fresh golden pomfret, washing the golden pomfret with clear water, soaking the golden pomfret in a fresh-keeping solution, draining the golden pomfret, and sub-packaging the golden pomfret subjected to fresh-keeping into food sealing bags for preservation. The fresh-keeping liquid is prepared from the clausena lansium seed extract, the herba hyperici japonici extract, the fig leaf extract and other raw materials, can keep good antibacterial performance, can also form a film to obstruct gas and reduce the respiratory action of fish cells, can also reduce the digestion degree of nutrient substances of fish and reduce the metabolic process, and has the effects of improving the immunity of the fish and improving the quality of the fish. And formation of active oxygen and peroxidation of membrane lipid are avoided, so that the fresh-keeping effect is improved, and the refrigeration shelf life is effectively prolonged.

The utility model relates to the technical field of transplanting devices, and discloses a wampee fruit tree transplanting device which comprises a bottom plate, four telescopic cylinders are fixedly connected to the top of the bottom plate, the same layer plate is fixedly connected to the tops of the four telescopic cylinders, a clamping mechanism used for clamping a fruit tree is arranged at the top of the layer plate, and four rotating wheels are rotationally connected to the bottom of the bottom plate. Limiting discs are fixedly connected to the surfaces of the symmetrical sides of the four rotating wheels, a plurality of second sliding grooves are formed in the surfaces of the four rotating wheels, the second sliding grooves are annularly and evenly formed, protruding plates are slidably connected into the second sliding grooves, and moving mechanisms used for moving the protruding plates are arranged on the surfaces of the sides, close to the limiting discs, of the protruding plates. Through the arrangement of the convex plate, the phenomenon that the rotating wheel slips can be avoided, and when the protective shell drives the triangular plate to move forwards, the triangular plate can extrude the convex plate, so that the triangular plate can move out of the rotating wheel, the road holding force of the rotating wheel is increased, and the phenomenon that the rotating wheel slips is avoided.

The invention discloses sterilization equipment convenient for batch processing of dried clausena lansium fruits, and relates to the technical field of sterilization of dried clausena lansium fruits, the sterilization equipment comprises a sterilization box, the sterilization box is used for sealed containing of the dried clausena lansium fruits, sliding grooves are formed in the two sides of the outer surface of the sterilization box, and a protective cover is rotatably mounted in the middle of the outer surface of the sterilization box; and a handle is fixedly mounted on the outer surface of the protective cover. According to the sterilization equipment convenient for batch processing of the dried clausena lansium fruits, the two sides of a limiting frame are both spaced from a sterilization box, a worker pulls a pull plate, so that the pull plate drives a first elastic rod and a second elastic rod to slide and move in a limiting pad, the first elastic rod is connected with a penetrating rod, and the penetrating rod is connected with the limiting pad; a penetrating rod drives a separation strip, a limiting frame and a stirring piece to slide and move in the sterilization box when a first elastic rod slides, so that raw materials placed on a laying plate are stirred by the stirring piece to be distributed more dispersedly, the raw materials are turned over while being sterilized, the heated surfaces of the raw materials are adjusted conveniently, and the sterilization and drying efficiency is improved.

The present application relates to the technical field of essence, in particular to a liquid essence of Clausena lansium, a preparation method and application thereof, the liquid essence of Clausena lansium comprises the following components by mass percentage: Clausena lansium d-limonene extract 2-5%, Clausena lansium base 15-30%, propylene glycol added to 100%, compared with traditional liquid essence, the liquid essence of Clausena lansium combines Clausena lansium d-limonene extract with base raw materials, wherein d-limonene is used as a solvent for Clausena lansium d-limonene extract, and the flavoring substances of Clausena lansium pericarp are extracted by ultrasonic extraction method, so that the aroma and taste are more truly restored.

New and distinct varieties of Pongamia pinnata (L) Pierre trees (pongamia trees) are described herein.

The invention discloses a method for improving citrus aroma quality by externally applying miRNA, and belongs to the technical field of agricultural biology. According to the present invention, the citrus fruits are soaked in the aqueous solution of the exogenous miRNA with the sequence of UGAUGAGCCGUGCCAAUAUC, such that the terpene metabolic pathway of the fruits is activated, and the accumulation of the key volatile substances such as monoterpene, sesquiterpene and the like in the clausena lansium layer is improved so as to significantly enhance the sensory evaluation aroma; the method is a non-transgenic green treatment technology, is simple and convenient to operate, takes effect quickly, and can be applied to high-quality fresh-eating citrus production, citrus processing and essential oil extraction industries.

The invention discloses a preparation method of probiotic dried clausena lansium fruits. The method comprises the following steps: selecting, cleaning, de-enzyming, sterilizing and drying the surface, preparing bacillus natto liquid, inoculating bacillus natto, fermenting at low temperature, coating powder and uniformly shaking, fermenting at low temperature again, drying and the like. The dried clausena lansium fruit product which is healthy, safe, remarkable in health-care effect, unique in flavor, rich in nutrition and rich and diversified in taste is provided for consumers through innovative technologies of no sweetening agent or pigment, bacillus natto liquid fermentation, low-temperature fermentation, chickpea powder wrapping and the like. The novel probiotic dried clausena lansium not only meets the requirements of the market on healthy and natural foods, has a wide market prospect, but also has obvious advantages in the aspects of product quality and market competitiveness.

The invention discloses a method for removing clausena lansium mineral particles in quartz sand in an acid-free environment. Belongs to the technical field of mineral purification. According to the invention, dangerous chemicals such as sulfuric acid, hydrofluoric acid and the like which must be used in the traditional process are completely abandoned, the generation of acidic wastewater and waste gas is eliminated from the source, and environmental protection pain points and potential safety and health hazards faced by the industry are solved; through the synergistic effect of magnetic separation, flotation and color separation, iron minerals can be effectively removed, and an excellent removal effect is also achieved on aluminosilicate gangue minerals which are difficult to treat through traditional acid pickling; according to the method, no acid liquor is used, and expensive and complex acid neutralization, wastewater treatment links and equipment corrosion prevention investment are omitted; in conclusion, the method provided by the invention does not need strong acid intervention, is environment-friendly, low in cost and good in purification effect, solves the long-term core difficulty of the industry, and has important application value.

The invention relates to the field of food, in particular to a chicken skin fruity macadamia nut fermented beverage and a preparation method thereof. The preparation method comprises the following steps: (1) mixing macadamia nut pulp with water, and sequentially juicing and filtering to obtain nut pulp; (2) sequentially performing astringency removal, soaking and juicing on the clausena lansium fruits, performing primary filtration on the squeezed fresh juice stock solution with water, performing enzymolysis on the filtrate, and performing filtration again to obtain clausena lansium fruit juice; (3) mixing the chicken skin juice, the white granulated sugar, the stachyose and the nut pulp, and sterilizing to obtain a mixed material; and (4) inoculating lactobacillus plantarum into the mixed material, fermenting, and sterilizing to obtain the chicken skin fruity macadamia nut compound fermented beverage. The obtained product has macadamia nut fragrance and fermentation flavor, is moderate in sour and sweet, appropriate in taste and relatively stable in quality, and meets the requirements of consumers.

The invention belongs to the technical field of microbial engineering, and particularly relates to saccharomyces cerevisiae and application thereof in wampee fruit wine brewing. The saccharomyces cerevisiae BJQ-7 (GDMCC No: 66508) is used for brewing the clausena lansium fruit wine, shows a remarkable environmental stress tolerance advantage, has the characteristics of high temperature resistance, sugar tolerance, ethanol tolerance and strong acid environment resistance, and can maintain higher cell activity, and these characteristics show that the BJQ-7 has better ecological competition potential in a complex fermentation system, so that the saccharomyces cerevisiae BJQ-7 can be used for brewing the clausena lansium fruit wine. The alcoholic strength, the total phenol content and the total flavone content of the fermented clausena lansium fruit wine are all higher than the fermentation effect of Angel yeast, it is indicated that the clausena lansium fruit wine brewed through BJQ-7 has better oxidation resistance, a special strain resource can be provided for brewing of the clausena lansium fruit wine, a theoretical basis is provided for industrial development of the clausena lansium fruit wine, and the clausena lansium fruit wine has good application prospects. The method has a good application prospect in industrial production.

The present invention discloses a volatile oil from Clausena lansium seeds for treating dental caries. The present invention also discloses an extraction method, an analysis method of the volatile oil from Clausena lansium seeds and its applications in the preparation of anti-caries drugs, the preparation of anti-Streptococcus mutans drugs, and the preparation of anti-dental biofilm drugs. The present invention makes full use of Clausena lansium seeds which are rich in resources and mostly discarded. The volatile oil from Clausena lansium seeds is extracted by a volatile oil analyzer, and its components are analyzed by GC-MS. The paper disk diffusion method and the microdilution method are used to determine that it has a certain inhibitory effect on Streptococcus mutans. The XTT method confirms that the volatile oil from Clausena lansium seeds has the effect of anti-biofilm formation. This provides a feasibility for the current difficult problem of dental caries treatment. Natural products have the advantages of being effective, safe, and not easily developing drug resistance, etc., providing an experimental basis for their research as natural anti-caries drugs.

The application belongs to the technical field of bioengineering, and discloses a gene ClPHL6 for regulating sugar content of Clausena lansium fruits and application of the gene, and specifically discloses application of the ClPHL6 in regulating soluble sugar content of plant leaves / fruits. The ClPHL6 gene of Clausena lansium is screened for the first time, and it is verified through experiments that the ClPHL6 gene can significantly enhance accumulation of soluble sugar content in tobacco leaves and tomato fruits. The ClPHL6 gene can be used as a target gene for in-depth research on regulation of soluble sugar content of Clausena lansium fruits and improvement of fruit flavor, and has high application and research value.