4 results about "Clausena lansium" patented technology

The utility model discloses a clausena lansium picking claw, which belongs to the technical field of fruit picking tools and comprises an adjusting rod, a picking seat is arranged at the top end of the adjusting rod, movable frames are fixedly connected to the periphery of the top end of the picking seat, and special-shaped picking plates are rotatably connected to inner cavities of the movable frames. An adjusting mechanism used for changing the angle of the special-shaped picking plate is installed on the upper surface of the picking base, the bottom end of the adjusting mechanism penetrates through the picking base and is provided with a pull rope, a plurality of sets of positioning blocks are arranged at the bottom end of the pull rope, a pull rod base is arranged at the bottom end of an adjusting rod, and a clamping groove is formed in the surface of the pull rod base; a supporting structure for supporting the pull rope is arranged at the bottom end of the pull rod seat, so that the length of the rod body can be adjusted, clausena lansium fruits of different heights can be picked, convenience is provided for picking work of the clausena lansium fruits, and the picking efficiency of the clausena lansium fruits is improved.

The present application relates to the technical field of essence, in particular to a liquid essence of Clausena lansium, a preparation method and application thereof, the liquid essence of Clausena lansium comprises the following components by mass percentage: Clausena lansium d-limonene extract 2-5%, Clausena lansium base 15-30%, propylene glycol added to 100%, compared with traditional liquid essence, the liquid essence of Clausena lansium combines Clausena lansium d-limonene extract with base raw materials, wherein d-limonene is used as a solvent for Clausena lansium d-limonene extract, and the flavoring substances of Clausena lansium pericarp are extracted by ultrasonic extraction method, so that the aroma and taste are more truly restored.

The invention discloses a method for improving citrus aroma quality by externally applying miRNA, and belongs to the technical field of agricultural biology. According to the present invention, the citrus fruits are soaked in the aqueous solution of the exogenous miRNA with the sequence of UGAUGAGCCGUGCCAAUAUC, such that the terpene metabolic pathway of the fruits is activated, and the accumulation of the key volatile substances such as monoterpene, sesquiterpene and the like in the clausena lansium layer is improved so as to significantly enhance the sensory evaluation aroma; the method is a non-transgenic green treatment technology, is simple and convenient to operate, takes effect quickly, and can be applied to high-quality fresh-eating citrus production, citrus processing and essential oil extraction industries.

The invention discloses a method for removing clausena lansium mineral particles in quartz sand in an acid-free environment. Belongs to the technical field of mineral purification. According to the invention, dangerous chemicals such as sulfuric acid, hydrofluoric acid and the like which must be used in the traditional process are completely abandoned, the generation of acidic wastewater and waste gas is eliminated from the source, and environmental protection pain points and potential safety and health hazards faced by the industry are solved; through the synergistic effect of magnetic separation, flotation and color separation, iron minerals can be effectively removed, and an excellent removal effect is also achieved on aluminosilicate gangue minerals which are difficult to treat through traditional acid pickling; according to the method, no acid liquor is used, and expensive and complex acid neutralization, wastewater treatment links and equipment corrosion prevention investment are omitted; in conclusion, the method provided by the invention does not need strong acid intervention, is environment-friendly, low in cost and good in purification effect, solves the long-term core difficulty of the industry, and has important application value.