113 results about "Muscle disorder" patented technology

An isolated nucleic acid that includes the nucleotide sequence: CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 12) is provided. In some embodiment, the nucleic acid includes at least one chemically-modified nucleotide. The nucleic acid and composition containing same find use in treating conditions associated with inflammation and / or fibrosis, for example, without limitation, heart conditions, such as hypertrophic myocardiopathy, myocardial infarction, and heart failure with preserved ejection fraction; muscle disorders, such as muscular dystrophy; skin disorders, such as scleroderma; and inflammatory conditions, such as autoimmune conditions or inflammatory conditions associated with a viral infection.

The present disclosure relates to compounds of Formula I:suitable for treating, ameliorating and / or preventing neuromuscular disorders, including the reversal of drug-induced neuromuscular blockade. The compounds as defined herein preferably inhibit the CIC-1 ion channel.

Described herein are methods and systems for using orofacial myofunctional therapy to non-surgically treat orofacial muscle disorders (OMDs) in a patient. The methods and systems combine orofacial myofunctional therapy exercises with an oral appliance. The methods and systems may include a three-phase orofacial myofunctional therapy program that can vary in length depending on patient diagnosis and evaluation by a healthcare professional.

A phosphorothioate-containing RNA molecule that includes the nucleotide sequence: 5'-NCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC-3' (SEQ ID NO: 1), where N is uracil or thymine, is provided. The RNA molecule can include one or more phosphorothioate bonds between nucleic acid residues in one or more pairs (e.g., between nucleic acid residues in each pair) of consecutive nucleic acid residues within SEQ ID NO: 1. The RNA molecule and compositions thereof find use in treating muscle disorders, such as muscular dystrophy, heart conditions, such as heart failure or myocardial infarction, and / or conditions associated with inflammation and / or fibrosis.

The present disclosure generally relates to the treatment of subjects having muscle disorder or at risk of developing muscle disorder by administering a Folliculin Interacting Protein 1 (FNIP1) inhibitor and / or a Folliculin (FLCN) inhibitor to the subject.

Disclosed herein are compositions that are useful for targeting a signaling pathway modulator to a muscle cell. In some instances, such compositions may be useful in treating a muscle disorder, such as muscular dystrophy.

The invention provides a phenoxy (hetero) aryl ether with anti-proliferative activity. The invention of the present application includes novel aromatic molecules useful in the treatment of pathological conditions, such as cancer, skin diseases, muscle disorders, and immune system-related disorders, such as disorders of the hematopoietic system, including the blood system, in human and veterinary medicine.

To provide an antisense oligonucleotide for preventing, delaying, and / or treating a human cis-element repeat instability-associated genetic disorder.SOLUTION: A medicament comprises, as an active ingredient, an oligonucleotide, wherein the oligonucleotide comprises 2'-O-methyl RNA nucleotide residues, has a backbone with at least one phosphate moiety being replaced by a phosphorothioate moiety, and comprises or consists of a repetitive nucleotide unit (XYG)m, wherein m is an integer from 4 to 12, each X is C or 5-methylcytosine, each Y is U or 5-methyluracil, and at least one X is 5-methylcytosine.SELECTED DRAWING: None

Provided herein are compounds of Formula (I): (I), or a pharmaceutically acceptable salt or composition thereof, which are useful in the treatment or management of diseases or disorders mediated by AAK1 activity, muscle diseases and disorders, and other conditions.

The present invention relates to compounds of formula 1: # imgabs0 # and their use as STING antagonists, for example, the composition is used for treating diseases selected from the group consisting of systemic lupus erythematosus (SLE), (single and double gene) interferon diseases (including STING-related vascular disease (SAVI), Aicardi-Goutires syndrome (AGS), COPA syndrome and familial chilblain-like lupus, DNASE2 or ATAD3A gene mutated type I interferon disease, age-related macular degeneration (AMD), retinopathy, glaucoma, lupus erythematosus, lupus erythematosus, lupus erythematosus, lupus erythematosus, lupus erythematosus, lupus erythematosus, lupus erythematosus, lupus erythematosus, lupus erythematosus, lupus erythematosus, and lupus erythematosus. Amyotrophic lateral sclerosis (ALS), diabetes, obesity, inflammatory bowel disease (IBD), chronic obstructive pulmonary disease (COPD), Bloom syndrome, sicca syndrome, Parkinson's disease, heart failure and cancer, systemic sclerosis (SSc), dermatomyositis, non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), chronic plus acute liver failure (ACLF), interstitial lung disease (ILD), idiopathic pulmonary fibrosis (IPF), and the like. , aging / muscle disease, sepsis, heart failure, rheumatoid arthritis, and osteoarthritis.

The present invention relates to an inhibitor of the METTL3-METTL14 complex, or a pharmaceutically acceptable salt or solvate thereof, for use in the treatment of neuromuscular degenerative pathologies. These pathologies are preferably caused by or linked to mutations in the FUS gene and / or by the accumulation of pathological protein aggregates or aberrant stress granules. The inhibitor can be used alone or in combination with other pharmaceutically active ingredients. Additionally, the invention includes pharmaceutical compositions comprising the inhibitor and a pharmaceutically acceptable carrier or excipient, potentially combined with other agents known to treat or mitigate neuromuscular disorders.

The portable controllable suspension vibrator for rehabilitation is installed on a rope of a suspension instrument and comprises a shell, a vibration motor and two vibration plates, the vibration motor is arranged in the shell, and the two vibration plates are symmetrically arranged at the two ends of the shell and extend in the length direction of the shell; the front end faces of the two vibration plates are each provided with a connecting piece, and the two connecting pieces are symmetrically arranged and detachably connected with the corresponding ropes. According to the utility model, the suspension apparatus of the rehabilitation training device is connected with the vibrating plate through the rope, the vibrating plate is vibrated through the vibrating motor, and the vibration is transmitted to a patient on the rehabilitation training device through the rope, so that the patient is subjected to vibration treatment, and the rehabilitation training device is used for assisting in treating neuromuscular diseases, relieving pain, activating muscle functions and the like. The device is externally connected to the rehabilitation training device and can be adjusted according to the requirements of a patient, the structure of an original rehabilitation training device does not need to be changed, installation is convenient, and cost is low.

Provided herein are compounds and compositions useful in increasing PPARδ activity. The compounds and compositions provided herein are useful for the treatment of PPARδ related diseases (e.g., muscular diseases, vascular disease, demyelinating disease, and metabolic diseases).

The invention relates to constitutively active mutants of the transcription factor TFEB, which can mutate the lysine of one or both sites of positions 219 and 347; and / or also mutate the glutamic acid of one or both sites of positions 221 and 349, in order to eliminate the SUMOylation of the protein. By replacing these residues either from positions 219 and / or 221 and / or 347 and / or 349 by any other amino acid (such as arginine or alanine), it gives rise to a mutated TFEB, which more actively induces the expression of genes and protein synthesis of the lysosomal and autophagic pathway. Such as lysosomal storage disorders, neurodegenerative diseases, liver diseases, muscle diseases and metabolic diseases, and / or disorders or processes in the aging of the skin.

The present invention relates to a synergistic composition for enhancing activity of PINK1 / PARKIN pathway. Particularly, the present invention relates to synergistic bioactive composition comprising combination of benzo-coumarin compound and at least one cell viability enhancer along with pharmaceutically acceptable excipients. The composition is useful in the treatment of obesity, diabetes, cancer, liver diseases, sexual dysfunction, neurodegenerative diseases, cardiovascular diseases, osteoarthritis, musculoskeletal diseases, neuromuscular diseases, and kidney diseases.

The invention belongs to the technical field of biology, and discloses an application of sodium crotonate in the aspect of regulating and controlling muscle development, and an application of sodium crotonate in serving as and / or preparing a medicine for regulating and controlling muscle development. The invention discloses the dual effects of sodium crotonate in skeletal muscle development regulation for the first time, and provides a new potential target and a chemical intervention approach for muscle regeneration and treatment of atrophic myopathy and metabolic muscle diseases. On the other hand, the sodium crotonate is a low-toxicity metabolite, can be used in conventional solution preparation and injection modes, and has application prospects.

The present disclosure generally relates to the treatment of subjects having muscle disorder or at risk of developing muscle disorder by administering a Folliculin Interacting Protein 1 (FNIP1) inhibitor and / or a Folliculin (FLCN) inhibitor to the subject.

The present invention discloses an oral muscle training system, comprising an oral muscle training space and an oral muscle training method on a computer built into the oral muscle training space, wherein a video module is installed on the top of the inner layer of the oral muscle training space, and a temperature and humidity control module is installed on the front and back lower parts of the inner layer of the oral muscle training space. The outer layer of the oral muscle training space is a solid wall, and the inner layer of the oral muscle training space is composed of 5 LED display screens. The video module, temperature and humidity control module, and LED display screen are all connected to the computer by wired or wireless communication; the oral muscle training method comprises the following steps: independently designing a training script or importing a standard training script; completing the training according to the training script; and evaluating the user to obtain an evaluation result. The present invention can provide a more interesting and effective training method for patients with oral muscle disorders, combining education with entertainment. The system of the present invention can automatically adjust the temperature and humidity during the training process to help users reduce sensitivity.

The apelin receptor modulator can improve the physical performance of a human patient, slow the progression of age-related weakness, and can reduce age-related muscle weakness. The present disclosure provides methods of treating muscle disorders using specific classes of apelin receptor modulators (e.g., agonists). The muscle condition may be an age-related muscle condition. Also provided is a method of maintaining and / or increasing muscle mass, muscle function, and / or muscle strength in an elderly subject by administering an apelin receptor modulator. In some embodiments, an apelin receptor modulator (e.g., an agonist) is BGE-105 or a pharmaceutically acceptable salt thereof.

Provided herein are compounds of Formulae (I) and (II), and pharmaceutically acceptable salts, solvates, hydrates, polymorphs, co-crystals, tautomers, stereoisomers, isotopically labeled derivatives, and prodrugs thereof. Also provided are methods, uses, and kits involving the disclosed compounds and pharmaceutical compositions thereof for treating and / or preventing a disease (e.g., a metabolic disorder (e.g., obesity, diabetes), a hypoxia related disease (e.g., a proliferative disease, inflammatory disease, neuromuscular disorder, neurodegenerative disorder, hypoxia, ischemia, oxidative stress, or a mitochondrial DNA related disorder), or a disease resulting from rhodoquinone depletion (e.g., a proliferative disease, inflammatory disease, neuromuscular disorder, metabolic disorder, or neurodegenerative disorder)) in a subject.

The present invention relates to a peptide having muscle formation-promoting activity, anti-obesity activity, fatty liver-inhibiting activity, or anti-diabetic activity, and to a use thereof. Specifically, the peptide of the present invention exhibits activities of inhibiting muscle loss, increasing muscle mass, promoting lipid degradation in hepatocytes or adipocytes, suppressing insulin resistance signaling, or enhancing insulin sensitivity signaling. The peptide of the present invention can be effectively used as an active ingredient in a pharmaceutical composition or a food composition for treating, preventing, or alleviating muscle diseases, obesity, fatty liver, or diabetes.

The present invention provides nucleic acid molecules and methods that result in changes in DUX4 expression leading to the treatment of FSHD. The nucleic acid molecules of the invention comprise a miR scaffold and a guide miR sequence targeting a double homeobox 4 (DUX4) transcript. By targeting DUX4 transcripts, the nucleic acid molecules of the invention result in an appropriate expression profile for the DUX4 gene.

Described herein are polypeptides with an IGF2 amino acid sequence and an amino acid sequence from a heterologous polypeptide for treatment of soft-tissue and muscle diseases, disorders, and injuries. Mutations within the IGF2 amino acid sequence improved stability by reducing backbone cleavage. Synergistic combinations of an Insulin-like Growth Factor 1 Receptor (IGF1R) agonist and a short chain fatty acid are also described. Methods of treating muscle and soft-tissue diseases comprising administering the polypeptides and / or synergistic compositions are provided herein.

Various methods and compositions for treating age-associated conditions and other medical conditions, such as muscle diseases, type 2 diabetes, and / or obesity are described. Methods of enhancing cellular uptake of NMN and stimulating NAD+ production are further described. Various mammalian cells and mammalian cell lines are described including those comprising a cDNA encoding a Slc12a8 protein. Gene therapy vectors comprising a nucleic acid encoding Slc12a8 and non-human animals comprising an inactivating mutation in a Slc12a8 gene are also disclosed. Also described are methods for screening a candidate compound to identify compounds that promote NMN transport.

Disclosed herein are compositions that are useful for targeting a signaling pathway modulator to a muscle cell. In some instances, such compositions may be useful in treating a muscle disorder, such as muscular dystrophy.

The present invention relates to a phytochemical-containing albumin nanocomplex and a composition containing the same for improving muscle diseases. More specifically, the present invention relates to a phytochemical-containing albumin nanocomplex that has the effect of suppressing muscle loss caused by oxidative stress or inflammatory responses and promoting the differentiation of myoblasts into muscle cells. The phytochemical-containing albumin nanocomplex effectively delivers phytochemicals to immune cells that induce reactive oxygen species and inflammatory responses, thereby regulating the muscle loss signaling mechanism induced by reactive oxygen species and inflammatory responses, suppressing muscle cell atrophy, and promoting differentiation. This can improve muscle loss and prevent and treat muscle atrophy. Therefore, a composition containing the phytochemical-containing albumin nanocomplex of the present invention can be provided as a composition for improving muscle diseases.

Provided is a composition for preventing, improving, or treating muscular disorders including sulfonamide-based compounds or salts thereof. According to the present disclosure, the sulfonamide-based compounds or salts thereof may prevent inhibition of differentiation of myoblasts by regulating the expression of PHF20 and YY1. Accordingly, since the composition may prevent or alleviate muscle loss, promote muscle regeneration, and improve muscle exercise function, balance ability, and grip strength recovery ability through increased muscles and changes in ratio of muscle fibers, the composition may be effectively used for therapeutic agents, foods, or feeds for preventing, improving or treating muscle disorders, and improving muscle functions or muscle mass.

The present invention includes novel aromatic molecules which can be used for treating pathological conditions in human and veterinary medicine, such as cancer, skin diseases, muscle disorders, and immune system-related disorders, such as disorders of the hematopoietic system including the blood system.