Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

20 results about "Intrinsic fluorescence" patented technology

Intrinsic fluorescence is a powerful indicator of protein structure and function. The amount of fluorescence can often give the researcher insight into the protein’s conformational states or activity under different biological conditions including changes in temperature, pH and ion concentration.

Detection method of adenosine deaminase content and application thereof

The application provides an adenosine deaminase content detection method and application thereof. The adenosine deaminase content detection method comprises the following steps: using the intrinsic fluorescence of adenosine, using adenosine deaminase to hydrolyze adenosine, and detecting the content of adenosine deaminase by a fluorescence analysis method. Adenosine itself has strong fluorescence, and after being hydrolyzed by adenosine deaminase, the fluorescence of the obtained hydrolysis product is reduced, thereby causing the fluorescence intensity of the solution of the detection system to be reduced; the content of adenosine deaminase in the system is detected by the change of the fluorescence intensity before and after adenosine hydrolysis. The adenosine deaminase content detection method in the application is simple to operate, does not need large instruments and equipment, and is cheap and easy to obtain materials, can accurately and rapidly detect the content of adenosine deaminase in a sample to be detected, has good sensitivity and specificity, and has a relatively wide application prospect.
Owner:INSTITUTE OF ENVIRONMENT AND SUSTAINABLE DEVELOPMENT IN AGRICULTURE CAAS

Divalent fluorescence enhanced aptamer and method for visually detecting aflatoxin B1

The invention belongs to the technical field of fluorescence sensors, and relates to a divalent fluorescence enhanced aptamer and a method for visually detecting aflatoxin B1. The nucleotide sequence of the divalent fluorescence enhanced aptamer is CGTACTTATACGAAACGACAAATTGAGAGGCAC AATCAACTGCGGGG CGT, and the nucleotide sequence of the divalent fluorescence enhanced aptamer is CGTACTTATACGAAAACGAAAACGAAAGAGGCAC. The divalent fluorescence enhanced aptamer provided by the invention can specifically recognize aflatoxin B1 and amplify intrinsic fluorescence of the aflatoxin B1, has relatively strong anti-interference capability and high sensitivity, and meets the requirement of sensitive detection; the detection cost is low, and the field detection of the aflatoxin B1 can be realized without a complicated instrument.
Owner:SHAANXI NORMAL UNIV

Yellow-green fluorescent water-borne epoxy resin for photovoltaic aluminum profile and preparation method of yellow-green fluorescent water-borne epoxy resin

The invention relates to the technical field of environment-friendly high polymer materials and functional coatings, and discloses yellow-green fluorescent water-borne epoxy resin for photovoltaic aluminum profiles and a preparation method of the yellow-green fluorescent water-borne epoxy resin. The method comprises the following steps: S1, synthesizing fluorescent dihydric alcohol (NTDI-Diol), S2, synthesizing a fluorescent dicarboxylic acid chain extender (CA-Fluo), S3, taking the CA-Fluo as a chain extender, carrying out ring-opening addition reaction with epoxy resin, and carrying out composite hydrophilic modification and phase inversion emulsification, so as to prepare the waterborne epoxy resin with low-temperature rapid curing, high flexibility and intrinsic fluorescence function. According to the invention, the synergism of technical characteristics and effects is realized through molecular structure design, and the coating can be hard-dried at 5 DEG C for 36 hours, has fluorescence performance and excellent salt fog resistance, is suitable for high-end industrial coating of photovoltaic aluminum profiles and the like, and has a good application prospect.
Owner:XIAMEN ANTAI NEW ENERGY TECH

System and method for rapid and label-free imaging of biological tissues based on microscopy with ultraviolet single-plane illumination

A rapid, label-free, non-destructive imaging method and system (100) for unprocessed biological tissue, which is based on microscopy with ultraviolet single plane illumination (MUSI). The present system (100) or method employs a selective two-axis planar illumination configuration, which decouples the illumination from the detection path, and utilize the intrinsic fluorescence of certain endogenous fluorophores from biological tissues as a natural source compared to deep UV illumination sources. In contrast to images produced by clinical standard methods (i.e. H&E staining of formalin-fixed and paraffin-embedded tissues), images generated by MUSI reveal comparable or even better diagnostic features, providing clinicians, pathologists, and surgeons with greater potential as post-operative and intra-operative diagnostic tools.
Owner:THE HONG KONG UNIV OF SCI & TECH

A microplastic quantitative analysis method based on fluorescence detection model and three-dimensional reconstruction technology

This invention discloses a quantitative analysis method for microplastics based on a fluorescence detection model and three-dimensional reconstruction technology, belonging to the field of microplastic detection, a typical emerging pollutant. The invention includes preprocessing the microplastic sample to impart intrinsic fluorescence properties, acquiring three-dimensional imaging data using a confocal fluorescence microscope, determining the material density based on the fluorescence fingerprint qualitative results of the microplastic type, and combining the volume data from the three-dimensional imaging reconstruction to achieve quantitative analysis of the microplastic's mass.
Owner:NANJING UNIV +1

Tumor inherent fluorescence diagnostic apparatus

The utility model discloses a tumor inherent fluorescence diagnostic apparatus, and relates to the technical field of inherent fluorescence diagnostic apparatuses. The diagnostic apparatus comprises a body, a connecting rope is arranged on one side of the diagnostic apparatus body, a light-guide fiber probe is fixedly installed at the end, away from the diagnostic apparatus body, of the connecting rope, and two fixing seats which are symmetrically distributed are fixedly installed on the side, close to the connecting rope, of the diagnostic apparatus body. A double-thread screw with opposite threads at two ends is rotatably mounted in the middle of the fixed seat, two symmetrically distributed moving blocks are in threaded connection with the outer side of the double-thread screw, and clamping blocks are fixedly mounted at the top ends of the moving blocks; the double-thread screw is arranged to drive the moving block and the clamping block to move towards the middle to clamp and fix the joint of the connecting rope and the diagnostic instrument body, so that the situation that the use of the diagnostic instrument body is affected due to the fact that the joint of the connecting rope and the diagnostic instrument body is separated during use is prevented.
Owner:ZHONGKEBAIER (NANJING) BIOTECHNOLOGY CO LTD

Micro thermophoretic molecule analysis system and method based on multi-laser cooperative control

The invention belongs to the technical field of thermophoresis analysis, and particularly relates to a microscale thermophoresis molecule analysis system and method based on multi-laser cooperative control. The system is characterized in that a laser module outputs infrared laser and at least two preset excitation light sources through an optical beam combining unit; generating a local temperature gradient and fluorescence excitation in the microfluidic sample cavity based on the output light path; the fluorescence analysis module is used for detecting the intrinsic fluorescence change of the protein sample based on the sample temperature change so as to determine the thermal stability of the protein sample, and judging to give up the trace thermophoresis detection, re-processing the sample or carrying out the interaction detection of the trace thermophoresis based on the thermal stability analysis result; detecting fluorescence change caused by trace thermophoresis due to local temperature gradient generated based on infrared laser heating; and the characteristic determination module determines the molecular characteristics of the protein sample based on the trace thermophoresis detection result and the thermal stability detection result. According to the invention, the system applicability is improved.
Owner:杭州市临安区青山湖未来产业科创中心 +1

Poly-eutectic stimulus-responsive fluorescent gel as well as preparation method and application thereof

The invention discloses a poly-eutectic stimulus-responsive fluorescent gel, and also discloses a preparation method and application of the fluorescent gel. The preparation method comprises the following steps: mixing a haplotype hydrogen bond acceptor and N-propylene N '-2-hydroxyethyl thiourea to obtain a mixture A, adding deionized water into the mixture A to obtain a mixture B, and heating and stirring the mixture B to obtain a polymerizable eutectic solvent; the preparation method comprises the following steps: adding guanosine, a photoinitiator and a cross-linking agent into a polymerizable eutectic solvent, heating and stirring to obtain a pre-polymerized solution; and casting the pre-polymerized solution in a mold, and initiating polymerization under the irradiation of an ultraviolet lamp to obtain the co-melting-based stimulus-responsive fluorescent gel. The preparation process of the fluorescent gel is green, environment-friendly, simple and efficient, and the obtained gel shows controllable mechanical performance and self-healing performance, has good and stable intrinsic fluorescence characteristics and can be applied to the fields of anti-counterfeiting, information encryption or flexible electronic devices.
Owner:XIAN UNIV OF TECH

Ink and preparation method thereof, film and photoelectric device

The invention discloses ink and a preparation method thereof, a thin film and a photoelectric device, and relates to the technical field of display. The ink comprises a nano material precursor and an alcohol compound; the nano-material precursor comprises Ax (OH) y (NH3) z, A is selected from metal elements, z is 2-6, the valence of A is + w, and x, y and w meet x * w = y; the alcohol compound comprises one or more selected from the following compounds: HO-(CHR1) m-(CHOH) n-(OC4H8) p-(OC3H6) q-(OC2H4) r-(OCH2) s-(CHR2) t-OH and R3-OH. When the ink is used for preparing the film, the nano material precursor can be decomposed to generate the nano material, and the alcohol compound in the ink can reduce the defects of the nano material and prolong the intrinsic fluorescence lifetime of the nano material.
Owner:SHENZHEN TCL HIGH TECH DEVELOPMENT CO LTD +1

A method for label-free detection of aflatoxin B1 in cereals based on intrinsic protein fluorescence

This invention discloses a label-free method for detecting aflatoxin B1 in grains based on intrinsic protein fluorescence. The method utilizes the mechanism of gold nanoparticles enhancing the intrinsic fluorescence of an artificial antigen (aflatoxin B1-bovine serum albumin) on the surface of photonic crystal microspheres. Aflatoxin B1 monoclonal antibody is immobilized on the surface of the gold nanoparticles, and the artificial antigen aflatoxin B1-BSA is immobilized on the surface of the photonic crystal microspheres. After incubating aflatoxin B1 standard or sample extract with the gold nanoparticles and photonic crystal microspheres modified with the above-mentioned biomolecules, the fluorescence signal of the photonic crystal microspheres is detected. The aflatoxin B1 in the sample is qualitatively and quantitatively detected based on the fluorescence signal of the microspheres. This invention can sensitively and specifically detect aflatoxin B1 in samples, reducing detection costs.
Owner:NANJING NORMAL UNIVERSITY

Protein polyacrylamide gel electrophoresis-online intrinsic fluorescence imaging analysis device and method

The present invention relates to a protein polyacrylamide gel electrophoresis (PAGE)-online intrinsic fluorescence imaging analysis device and method. The device is used for protein electrophoresis separation and online imaging detection of protein bands. The device includes: an open electrophoresis tank including an upper buffer chamber located in the upper part of the open electrophoresis tank, and a lower buffer chamber located in the lower part of the open electrophoresis tank; a UV light source used to excite protein bands in the gel to generate intrinsic fluorescence signals; a CCD imaging detection mechanism including a filter positioned at the front end of the CCD imaging detection device, a UV lens arranged between the filter and the CCD sensor, and a CCD sensor connected to a control unit; a control unit connected to the CCD sensor for online intrinsic fluorescence imaging.
Owner:BIOCHINE TECHNOLOGY (SUZHOU) CO LTD

Chitosan-Modified Durian Seed Gum as a Bioimaging Agent for Cancer Cells

PendingIDS00202607779ACancer cellPolymer chemistry
CHITOSAN-MODIFIED DURIAN SEED GUM AS A CANCER CELL BIOIMAGING AGENT This invention relates to a natural polymer material product in the form of polyelectrolyte complex particles composed of durian seed gum and chitosan. The product is made by mixing a solution of durian seed gum and a solution of chitosan to form colloidally stable submicron-sized particles. The particles are responsive to pH changes and exhibit improved kinetic stability and surface characteristics compared to unmodified durian seed gum. The resulting material exhibits intrinsic fluorescence without the addition of external fluorescent agents and has selective activity against cancer cells with high biocompatibility towards normal cells. This invention can be used as a bioimaging material, an intracellular tracking system, a carrier for active compounds, and a supporting material for natural-based cancer therapy.
Owner:UNIVS KATOLIK WIDYA MANDALA SURABAYA

Colorimetric-fluorescent dual-mode carcino-embryonic antigen immunoassay method based on dual-ligand iron metal organic framework nano-enzyme

The invention discloses a colorimetric-fluorescent dual-mode immunoassay method based on a dual-ligand iron metal organic framework (Fe-MOF) nano-enzyme, which is used for detecting protein tumor markers, taking carcinoembryonic antigen (CEA) as an example. The double-ligand Fe-MOF has both peroxidase simulation activity and intrinsic fluorescence, and is coupled with a labeled antibody Ab2 to form Fe-MOF-Ab2; a to-be-detected substance in a sample is captured by the solid-phase coated antibody Ab1 and then forms a sandwich compound with Fe-MOF-Ab2. After H2O2 / TMB is added, Fe-MOF is catalyzed to generate a blue oxidation product (oxTMB) to generate a 652 nm absorbance signal, and meanwhile, oxTMB generates internal filtration / energy transfer quenching on Fe-MOF fluorescence, so that absorbance enhancement-fluorescence weakening dual-channel quantification and mutual verification are realized. The method does not need a natural enzyme or an exogenous fluorescent probe, and is simple, convenient, rapid and reliable to operate.
Owner:MINNAN NORMAL UNIV

Intrinsic fluorescence generation using exogenous fluorescent agents

Methods, systems, and apparatus for determining glomerular filtration rate (GFR) by acquiring a measurement dataset. Furthermore, this disclosure includes: acquiring a measurement dataset comprising multiple measurement entries acquired before and after administration of an exogenous fluorescent agent; generating an intrinsic fluorescence (IF) signal, the IF signal representing the detected fluorescence intensity emitted from the exogenous fluorescent agent within a diffuse reflective medium; determining whether the IF signal includes a portion of early fluorescence data; after determining this portion of the early fluorescence data, identifying an operable IF signal range by filtering the IF signal associated with the early fluorescence data; determining a GFR value in the patient based on the rate of change of the operable IF signal; and providing the GFR value.
Owner:MEDIBEACON INC

Systems and methods for rapid, label-free imaging of biological tissues based on ultraviolet single-plane illumination microscopy

A method and system (100) for rapid, label-free, non-destructive imaging of intact biological tissues using microscopy with ultraviolet single plane illumination (MUSI). The system (100) or method employs a selective biaxial planar illumination configuration that decouples the illumination light from the detection path, and utilizes the intrinsic fluorescence of several specific endogenous fluorophores from biological tissues as a natural source, compared to deep UV illumination sources. In contrast to images obtained by clinical standard methods (i.e., H&E staining of formalin-fixed, paraffin-embedded tissues), images obtained by MUSI exhibit similar or even superior diagnostic characteristics, making them a potentially valuable post- and intraoperative diagnostic tool for clinicians, pathologists, and surgeons.
Owner:THE HONG KONG UNIV OF SCI & TECH

A yellow-green fluorescence quenching-preventing waterborne epoxy coating, and a preparation method and application thereof

The application discloses a yellow-green anti-quenching fluorescent water-based epoxy coating and a preparation method and application thereof, and belongs to the field of environment-friendly functional coatings. The coating comprises two components A and B. The component A takes CE-Fluo resin with covalently bonded NTDI fluorophore as the core, and is matched with rutile titanium dioxide and other anti-quenching components. The component B is compounded by a low-temperature curing agent and a BDMA accelerator. The application avoids ACQ quenching through intrinsic fluorescence design, eliminates pigment quenching through rutile titanium dioxide, realizes 5 DEG C fast curing through a low-temperature system, balances mechanical properties through a rigid-flexible combined resin, and the coating has high strength and high toughness, long-acting corrosion resistance and stable yellow-green fluorescence, and is suitable for 6005 aluminum alloy photovoltaic frames and precise instrument housings. The application solves the problems of fluorescent quenching, slow low-temperature curing and mechanical imbalance, realizes single-coating multi-functional integration, is environment-friendly and low in VOC, and is convenient to construct.
Owner:XIAMEN ANTAI NEW ENERGY TECH

Device and method for determining the sex of a fertilized bird egg

ActiveDE102022107397B4Testing eggsAvicultureOptical radiationIntrinsic fluorescence
Device (10) for determining the sex of a fertilized bird egg (12), with - a light source (14) for emitting pulsed excitation radiation (16), - a detection device (18) for detecting an intrinsic fluorescence radiation (20) emitted by the bird's egg (12), and - a computer-based evaluation device (22), wherein the detection device (18) is designed to detect the intrinsic fluorescence radiation (20) of the bird's egg (12) in a time-resolved manner at different wavelengths by means of time-correlated single photon counting and to provide the evaluation device (22) with two-dimensional data with a wavelength dimension and a time dimension, wherein the evaluation device (22) is designed to classify the provided data into classes by means of a classifier, wherein a first class represents a male sex of the fertilized bird egg (12) and a second class represents a female sex of the fertilized bird egg (12), wherein the evaluation device (22) is designed to identify specific wavelengths to be prioritized during the classification on the basis of features formed in the time dimension of the data by means of machine learning, and wherein the evaluation device (22) is designed to prioritize the data at the specific wavelengths in order to determine the sex of the bird's egg (12).
Owner:TECH HOCHSCHULE OSTWESTFALEN LIPPE KORPERSCHAFT DES OFFENTLICHEN RECHTS

Polycyclic aryl hyperbranched epoxy resin and preparation method and photoluminescent solution, anticorrosive coating and application obtained thereby

The present application belongs to the technical field of epoxy resin, and provides a polycyclic aryl hyperbranched epoxy resin and a preparation method thereof.The preparation method comprises the following steps: performing a branched polymerization reaction on a multifunctional epoxy compound and a polycyclic aryl diphenol under the condition of a catalyst to obtain a polycyclic aryl hyperbranched epoxy resin; the mass ratio of the multifunctional epoxy compound, the polycyclic aryl diphenol and the catalyst is 100:20-60:0.01-0.02.The present application further provides a photoluminescence solution and a corrosion-resistant coating containing the resin.The polycyclic aryl hyperbranched epoxy resin of the present application significantly improves the medium resistance and barrier properties of the coating; the polycyclic aryl hyperbranched epoxy resin has intrinsic fluorescence properties, can predict the failure of the steel corrosion-resistant coating, and can be used for the detection of metal ions.
Owner:BEIJING UNIV OF CHEM TECH

A water-soluble low-background cy5 probe, a construction method thereof and cross-instrument hypochlorous acid consistent detection application

PendingCN122344189ABiomedicineHypochlorous acid
The application belongs to the field of biomedical detection and molecular imaging technology, and specifically discloses a water-soluble low-background Cy5 probe, a construction method thereof and application of the probe to consistent hypochlorous acid detection across instruments. The probe Cy5Q1-HClO of the application takes Cy5 cyanine dye as a skeleton, realizes near-zero intrinsic fluorescence by means of a double photo-induced electron transfer (PET) mechanism, triggers a self-elimination cascade reaction after specific recognition of hypochlorous acid, and restores strong near-infrared fluorescence. The double-cation structure of the probe endows it with good water solubility, facilitating its use in biological systems. The spectral shift of the probe is extremely small before and after response, only the absorption and fluorescence intensity change, so similar working curves can be obtained on instruments with different excitation and detection channels, the probe has cross-platform and instrument-independent signal quantitative capability, thereby realizing high-sensitivity, zero-background interference and in-vivo precise imaging of HClO. The probe has the characteristics of water solubility, low background and high sensitivity, can not only visualize tumors with high contrast, but also guide precise resection of less than 2mm resection margin, and for the first time realizes longitudinal monitoring of dynamic changes of HClO in the postoperative wound healing process. The application also provides a preparation method and application of the Cy5Q1-HClO probe.
Owner:HUNAN PROVINCIAL TUMOR HOSPITAL +1

Manganese-based organic frameworks and methods of making the same, methods of drug delivery

The application provides a manganese-based organic framework and a preparation method and a drug delivery method thereof, wherein the manganese-based organic framework is generated through coordination connection of metal manganese ions and 1,1,2,2,-tetra(4-carboxyphenyl) ethylene ligands, the structure of the manganese-based organic framework is Mn2(TCPE)(H2O), wherein the TCPE is a fluorescent probe 1,1,2,2,-tetra(4-carboxyphenyl) ethylene. The manganese-based organic framework can be used as a nano-carrier with high drug loading capacity, can load active drug molecules with small and medium sizes, and can be used for treating cardiovascular diseases, cancers, microbial infections, wound healing, diabetes, senile dementia, tuberculosis and the like, and has no label and intrinsic fluorescence capacity, and can play a crucial role in actual experiments and interventions for detecting nano-carriers and rapidly tracking drugs.
Owner:HONG KONG CENT FOR CEREBRO CARDIOVASCULAR HEALTH ENG LTD