46 results about "Peptidoglycan transpeptidase" patented technology

The invention discloses a method for eliminating mecA plasmids based on CRISPR/Cas9 technology. The method comprises: selecting an MRSA strain to perform PCR amplification to a DNA sequence of a C terminal of mecA gene coding transpeptidase; carrying out gel extraction for mecA genes; connecting the mecA genes with a T-pMD19 (simple) carrier and preparing DH5[alpha] competent cells; electro-transforming the DH5[alpha] competent cells through the obtained T-pMD19-mecA plasmids; extracting the T-pMD19-mecA plasmids and performing sequencing and verification; performing double digestion treatment for the T-pMD19-mecA plasmids and performing gel extraction to the mecA genes; connecting pET-21a (+) plasmids with the mecA genes; designing and synthesizing oligos; constructing pCas9 :: mecA plasmids; electro-transforming the obtained pET-21a (+)-mecA plasmids into an escherichia coli expression strain BL21 (D3); and electro-transforming the pCas9 :: mecA plasmids and the pCas9 plasmids into BL21 (D3)+pET-21a(+)-mecA competent bacteria and BL21 (D3)+pET-21a(+) competent bacteria. The method is simple to operate and good in specificity, and can effectively block spread of mecA to eliminating the mecA strain.

The invention discloses a preparation method of solid phase peptide synthesis triptorelin, which includes the following steps: with Rink Amide AM resins or Rink Amide MBHA resins as starting materials, amino acids with protective groups are sequentially connected according to solid phase synthesis, so as to obtain protective decapeptide resins, and meanwhile crude products are obtained by sequentially removing Fmoc-protective groups and synchronously removing side-chain protective groups and cutting peptides, and triptorelin elaborate products are prepared after the crude products are separated and purified by C18 (or C8 ) column and freeze-dried. The preparation method is stable in technology, convenient in raw and auxiliary material sources, short in production cycle, high in yield, stable in quality, low in production cost and high in transpeptidase yield. Besides, as the preparation method avoids using poisonous reagents, such as hydrogen fluoride, and the like, the pollution of three wastes is low, purification yield is over 25 percent and each step of transpeptidase yield is above 98 percent; the yield after cutting peptides is 78.8 percent and the total yield is 25.4 percent.

The invention discloses a preparation method of solid phase peptide synthesis Exenatide which includes the following steps: taking Rink Amide resins, Rink Amide AM resins or Rink Amide MBHA resins as starting materials, amino acids with Fmoc protective groups are sequentially connected, so as to obtain protective thirty-nine peptide resins; and meanwhile, after thirty-nine peptide resins are obtained by sequentially removing Fmoc-protective groups and transpeptidase reactions by condensing agents, acellular side-chain protective groups and cutting peptides are carried out sychronously to obtain Exenatide crude products, and then products (comprising medical salts and free alkali, such as acetates, trifluoroacetate, etc.) are obtained after Exenatide crude products are separated and purified by C18 or C8 column and freeze-dried. The preparation method has the advantages of stable technology, conventient raw and auxiliary material sources, short production cycle, low production cost, few three wastes, high yield, stable yield, stable quality, low production cost and high yield.

A method of producing an immunoligand/payload conjugate can encompass conjugating a payload to an immunoligand by means of a sequence-specific transpeptidase, or a catalytic domain thereof.

The invention relates to a cyclic peptide which is provided with a residue fragment of -Ile-Sta-Pro- and is used as immunosuppressive agents, and the synthesis process of the cyclic peptide (Ile-Ile-Sta-Pro-Tyr-Val-Pro-Leu) consists of 1) removing amino-protecting groups, 2) transpeptidase reaction, 3) the cutting of peptide chain, 4) cyclization of peptide chain. The cyclic peptide compounds which are provided with the residue fragment of -Ile-Sta-Pro- and used as immunosuppressive agents and have a high yield and a high purity can be obtained, and the immunosuppressive activity of the cyclic peptide compounds is higher. Through the experiments of the retarding effect of A1HS1 towards the delayed hypersensitivity of mice, the influence of phagocytic function of macrophages, and the retarding effect of the proliferation of lymphocytes, the A1HS1 shows a stronger immunosuppressive effect than HS-1, which reaches or surpasses the immunosuppressive of the positive contrast (cyclosporine).

The invention discloses a method for efficient expression and secretion of transpeptidase Sortase A, and belongs to the field of genetic engineering. The method disclosed by the invention successfully achieves the efficient extracellular production of transpeptidase Sortase A in recombinant escherichia coli BL21 (DE3) by virtue of an addition strategy of adding glycine during inducing, so as to solve the existing problems of low transpeptidase Sortase A secretion rate and long fermentation cycle. By optimizing a target protein carrier as well as an additive and an addition strategy in a fermentation system, the method disclosed by the invention discovers that pET-22b carrier is suitable for the extracellular production of the Sortase A; and the method can be used for greatly improving the Sortase A extracellular production level of the escherichia coli by adding glycine in two stages (first stage: adding glycine which is 0.5% in final concentration during inducing, and second stage: adding 2% of glycine after 6h of inducing). The method disclosed by the invention achieves the efficient extracellular production of transpeptidase Sortase A in escherichia coli for the first time, so as to lay a foundation for subsequent Sortase A industrial production.

The invention discloses a method for efficiently producing transpeptidase sortase A by using recombinant escherichia coli, and belongs to the field of gene engineering. Efficient production of the sortase A in the escherichia coli is successfully achieved, the problem of lower expression level of the enzyme reported at present is solved, production is performed in a 7 L fermentation tank, and the yield of the sortase A can reach 295.2 mg/L and is increased by 58.5% than the yield before optimization; the enzyme activity of unit mass of thalli can reach 4845 U/mg and is increased by 52.8% than the activity before optimization. By system optimization of recombinant strain fermentation production conditions, a foundation is laid for subsequent sortase A industrialized production.

The present invention provides a system for determining a postoperative recurrent risk of a single HBV related primary liver carcinoma within 1 year. The system comprises an input device, a computingdevice and an output device, the computing device comprises a storage and a processor, a computer program is stored in the storage, the processor is configured to execute the computer program stored in the storage to achieve an algorithm of a discrimination function. The discrimination function returns the postoperative recurrent risk of the single HBV related primary liver carcinoma within 1 yearthrough the history of drinking, glutamyl transpeptidase (GGT), total serum protein content (TP) and alpha fetoprotein (AFP). Through baseline clinical features of biochemistry, virology and immunology, the system provided by the invention can determine the postoperative recurrent risk of the single HBV related primary liver carcinoma within 1 year and provides basis for clinical prognosis.

In various embodiments a system is provided that displays heterologous proteins on the surface of a Gram-positive microorganism. In certain embodiments the system displays proteins using a sortase transpeptidase to covalently anchor proteins to the cell wall of the microbe. Novel bacterial strains are provided to exploit this system to display cellulase enzymes and multi-enzyme complexes on the surface of Gram-positive microorganisms (e.g., Bacillus subtilis) through their non-covalent interaction with a scaffoldin protein that is covalently anchored to the cell wall by the sortase transpeptidase. The surface displayed protein complexes contain enzymes capable of degrading cellulose into its component sugars at accelerated rates as compared to solutions of purified enzymes.

The invention relates to a photochemical-transmission photometry method detection card capable of automatically filtering red blood cells and simultaneously detecting three indexes of a liver function: alanine transaminase (ALT), aspartate aminotransferase (AST) and glutamyl transpeptidase (gamma-GT or GGT) and belongs to the dry chemical analysis technology field. An automatic blood filtering dryphotochemical method microchannel liver function detection card is formed by five layers of film structures, and the structures contain holes and microchannels for loading, detecting and inlaying a blood filtering film. During a detection process, whole blood is filtered through the blood filtering film, and filtered serum enters into a detection hole through the microchannels. A detection item in a sample is quantitatively analyzed by testing the intensity changes of transmission light of the detection hole. By using the photochemical method microchannel liver function multi-item detection card, automatic blood filtering can be realized, the serum does not need to be separated, and the whole blood can be used to quickly and sensitively detect multiple biochemical indexes. A test result of the invention is linear, CV and other indexes can satisfy a clinical test requirement.

Methods of forming, dissolving, and functionalizing an extracellular matrix gel on demand based on cross-linking, modification, and dissolution of hydrogels using transpeptidase (e.g. sortase) are disclosed. Also provided are hydrogels comprising one or more macromers crosslinked to a mixture of peptides, wherein all or a portion of the peptides in the mixture comprise a recognition motif cleavable by a transpeptidase (e.g., sortase).

The invention discloses a synthesizing method for 9,10-dimethylanthracene, and belongs to the technical field of chemical synthesis. The method comprises the steps that o-xylene is taken as raw materials, under the action of a manganese acetate catalyst and a paraldehyde accelerant, acetic acid is added, and the materials are mixed and react; after centrifugal separation is performed, a mixture obtained in the last step is dissolved in water under the certain pressure, a sodium bromide catalyst is added, and after hydrogen gas is introduced for a reaction, filtering, washing and drying are performed to obtain phthalic acid; o-xylene is taken again, liquid bromine and iron powder are added to be mixed with the o-xylene, the temperature is lowered for a reaction, after cooling is performed, magnesium powder and glutamyl transpeptidase are added, and sealed preservation and enzymolysis are performed; a product obtained in the last step is taken out to be dried, the prepared phthalic acid is added, acetic acid and concentrated sulfuric acid are added, the materials are mixed and react, standing and filtering are performed, and drying is performed to obtain the 9,10-dimethylanthracene. The synthesizing method has the advantages that the synthesizing steps are simple, the preparation cost is low, by-products obtained in the synthesizing process are few, the obtained 9,10-dimethylanthracene is high in purity, and the yield reaches 94.5% or above.

Production of protein conjugate vaccines by use of transpeptidase enzymes, such as sortase enzymes. For example, homogenous immunoconjugates (e.g., a population of molecules having the same structure) formed by conjugating an antigenic polypeptide and a bacterial capsule component are provided. In certain aspects, methods for generating an immune response to B. anthracis by use of protective antigen-PDGA immunoconjugates are provided.

The invention relates to a cyclic peptide which is provided with a residue fragment of -Val-Sta-Leu- and is used as immunosuppressive agents, and the synthesis process of the cyclic peptide (Ile-Ile-Pro-Pro-Tyr-Val-Sta-Leu) consists of 1) removing amino-protecting groups, 2) transpeptidase reaction, 3) the cutting of a peptide chain, 4) cyclization of the peptide chain. The cyclic peptide compounds which are provided with the residue fragment of Val-Sta-Leu- and used as immunosuppressive agents and have a high yield and a high purity can be obtained, and the immunosuppressive activity of the cyclic peptide compounds is higher. Through the experiments of the retarding effect of A3HS1 towards the delayed hypersensitivity of mice, the influence of phagocytic function of macrophages, and the retarding effect of the proliferation of lymphocytes, the A3HS1 shows a stronger immunosuppressive effect than HS-1, which reaches or surpasses the immunosuppressive of the positive contrast (cyclosporine).

The invention discloses a method for modifying protein by using transpeptidase Sortase A, and belongs to the field of genetic engineering. According to the present invention, with magnetic beads capable of specifically adsorbing transpeptidase Sortase A,Sortase A is immobilized on the magnetic beads in one step so as to be used to catalyze conjugation and modification reactions of proteins or short peptides;and with the application of the prepared Sortase A conjugated magnetic beads to directly catalyze the transpeptidase conjugation reaction between the short peptide and the short peptide, the transpeptidase conjugation reaction between the protein and the Biotin, the transpeptidase conjugation reaction between the protein and the resin, the transpeptidase conjugation reaction between theshort peptide and the protein, and the like, the Sortase A conjugated magnetic beads can be recycled at least 5 times compared to the free enzyme, and can maintain the yield greater than the catalytic efficiency of free enzyme.

The invention discloses liver protection type saffron crocus-kudzuvine root yellow wine and a preparation method thereof. Saffron crocus and kudzuvine root active ingredients are added during secondary fermentation of yellow wine. The preparation method of the liver protection type saffron crocus-kudzuvine root yellow wine comprises the following three steps of: firstly, preparing saffron crocus active ingredients; secondly, preparing kudzuvine root active ingredients; and thirdly, preparing the yellow wine containing the saffron crocus and kudzuvine root active ingredients. The produced saffron crocus-kudzuvine root yellow wine has beautifying, antioxidation and anti-cancer effects, and main active ingredients such as puerarin and flavonoid in kudzuvine root and active substances such as alpha-crocetin and safranafe in saffron crocus can enhance activity of alcohol dehydrogenase in liver, improve concentration of glutathione in cell sap, enhance activities of glutathione S transpeptidase and glutathione peroxidase, lower cholesterol level and speed up fat metabolism, so that the yellow wine has native antialcoholism and liver protection functions, and brand new high-quality functional yellow wine is added for people.

The invention discloses an enzymatic transformation preparation method of [gamma]-L-glutamyl n-butylamine. The preparation method comprises the following steps: (1) conducting culture fermentation on a strain which has a [gamma]-glutamyl transpeptidase in a medium, and centrifuging fermentation liquid so as to obtain a wet bacterium containing the [gamma]-glutamyl transpeptidase; (2) adding transformation liquid to the wet bacterium, wherein the transformation liquid consists of L-glutamic acid-[gamma]-methyl ester, n-butylamine as well as one of 3-methoxybutyl acetate, butyl acetate, pentanol and hexanol; and (3) conducting an enzymatic reaction under the following conditions: a temperature is 35-50 DEG C and pH value is at 6-11, and conducting isolation by virtue of isoelectric point crystallization so as to obtain the [gamma]-L-glutamyl n-butylamine. The enzymatic transformation preparation method of the [gamma]-L-glutamyl n-butylamine provided by the invention has the advantages of being mild in reaction conditions, strong in enzymatic stereoselectivity, high in catalysis efficiency, low in cost and simple in technological process.

The invention discloses oligopeptide, a strong flavor agent, seasoning, and a preparation method and application of the oligopeptide. The oligopeptide gamma-Glu-gamma-Glu-gamma-Glu-Abu has high stability, and can remarkably increase strong flavor of food, especially the seasoning, under the concentration of 60-100mg/kg. The preparation method includes the specific steps: dissolving glutamine and 2-aminobutyric acid in water after mixing, adding glutaminase or gamma-glutamine transpeptidase accounting for 0.001-0.4% of the solution in mass, regulating pH of the solution to 7.0-10.0 by a 10mol/l sodium hydroxide solution, allowing reaction at the temperature of 25-50 DEG C for 3-12 hours, regulating the pH to 7-8 by 4mol/L hydrochloric acid, and performing enzyme deactivation at the temperature of 90 DEG C for 10 minutes.

The invention discloses a sweet peptide gamma-L-Glu-gamma-L-Glu-gamma-L-Glu-D-Val and a preparation method and application thereof. The preparation method specifically comprises the following steps: mixing L-glutamine with D-valine and dissolving the mixture in water; adding glutaminase or gamma-glutamine transpeptidase which is 0.001-0.4%(w/w) of the mass of the solution; adjusting the pH of thesolution with a 10 mol/l sodium hydroxide solution to 8.0-10.0; carrying out reaction for 3-12 hours at 25-50 DEG C; then adjusting the pH back to 6-7 with 4 mol/L hydrochloric acid; and carrying outenzyme deactivation for 10 min at 90 DEG C. The gamma-glutamine peptide (gamma-L-Glu-gamma-L-Glu-gamma-L-Glu-D-Val) prepared by the method has good stability, has a natural sweet waste like saccharose, and can increase or improve the sweetness of food if being applied to the food.

The invention relates to a detection carrier based on blood glucose meter detection. The detection carrier comprises a sensor sequence and a sucrase sequence. The sensor sequence is: TTTCGCTCTATTCTCATCAGTTTCATGTCCTGTGTCGGACTTTAGAACAGAGGAGATAAAGATGGACACAGGACACAACCTGGCGGCAGCGCAAAAGATGCGTAAA. The sucrase sequence is obtained by codon optimization of the amino acid sequence of the high temperature resistant sucrose. The sensor sequence and the sucrase sequence are connected together and introduced into a pET 21a vector together. Compared with the traditional target gene detection with the sucroseas a marker, the detection carrier based on the blood glucose meter detection does not require the preliminary purification and marking process, and the operation process is simple. In addition, the sucrase does not exist in the detection system. Compared with the traditional method, the detection carrier is relatively low in background leakage. Compared with the original foothold-mediated gene expression detection method, the detection carrier adopts the sucrose to replace the beta-galactosidase, fluorescent proteins, ethanol acetyltransferase, transpeptidase and the like, utilizes a commercial blood glucose meter for detection, is more portable and can detect lower gene concentration at the same time.

The invention relates to a method for a fixed-point labeled immunological reagent, the labeled immunological reagent and application. The method comprises the steps that firstly, the tail end of an antibody or an antigen is connected with a polypeptide fragment Leu-Pro-X-Thr-Gly; secondly, a signal molecule is connected with a polypeptide fragment the tail end of which contains at least three glycines; finally, the modified antibody or antigen, the modified signal molecule and transpeptidase Sortase A are mixed for a reaction to make the signal molecule quantitatively labeled on the antigen orthe antibody at a fixed point. A polyhydroxy compound is also added to the reaction as a protein protection agent, the activity of the antigen or the antibody can be effectively protected, the affinity damage, stability damage and the like, caused by transpeptidase Sortase A, of the antigen or the antibody are effectively avoided, the thermal stability and specificity of the labeled immunologicalreagent are greatly improved, the prepared labeled immunological reagent is small in batch difference, and the antigen or the antibody can also be greatly saved when the immunological reagent is applied to immunoassay.