37 results about "Methamphetamine" patented technology

The invention discloses application of lycium barbarum polysaccharide in preparation of a medicine for inhibiting methylamphetamine-induced nerve injury, and relates to the technical field of biological medicines. It is found and proved that lycium barbarum polysaccharide can inhibit methylamphetamine-induced nerve injury, and the effect is remarkable. From the aspect of cell survival, the survival rate of the microglial cells pretreated by the lycium barbarum polysaccharide after METH stimulation is obviously improved. In the molecular mechanism, the lycium barbarum polysaccharide can effectively lower the protein expression level of the METH-induced pyroptosis marker, the content of inflammatory factors IL-1beta and IL-18 can be reduced, and the release of lactic dehydrogenase is reduced. The result shows that the lycium barbarum polysaccharide can alleviate inflammatory response by inhibiting NLRP3 / ASC pathway mediated microglial cell pyroptosis, thereby inhibiting METH-induced nerve injury. The invention provides a new direction for developing METH neurotoxicity intervention medicines.

The present invention discloses a compound for treating methamphetamine addiction and cognitive impairment, its preparation method and application. The new compound NBU513-1 for treating methamphetamine addiction and cognitive impairment induced by the present invention can significantly improve the addictive behavior of mice for methamphetamine, has a therapeutic effect on the cognitive dysfunction caused by methamphetamine, and can be used to prepare a medicine for treating methamphetamine addiction and cognitive impairment induced by methamphetamine. The present invention provides a total synthesis route of compound NBU513-1. Compared with the preparation method of similar compounds in the prior art, the method of the present invention does not need to react with sodium azide, does not produce powerful explosives and highly toxic substances, has high stability and low reaction risk; the method has mild reaction conditions, simple scheme, safe and reliable production and can prepare target products with higher yields, and is suitable for industrial production.

The application belongs to the technical field of water treatment, and particularly relates to a new psychoactive substance adsorbent and application thereof. The preparation method of the adsorbent comprises the following steps: (1) mixing and reacting activated shrimp shell biomass and ferroferric oxide nano magnetic material, drying, and pyrolyzing to obtain Fe3O4@BC; (2) mixing and reacting Fe3O4@BC and ZIF-8 to obtain Fe3O4@BC@ZIF-8; and (3) mixing and reacting a eutectic solvent with Fe3O4@BC@ZIF-8 to obtain the new psychoactive substance adsorbent. The adsorbent has strong adsorption capacity for 4-methyl methcathinone, methcathinone, amphetamine, methamphetamine and ephedrine, and the adsorption efficiency can reach 98% for 4-methyl methcathinone in particular.

The invention relates to a polymeric nanomaterial that has specific affinity for MeA (methamphetamine) or AMP (amphetamine-derived synthetic drugs) and can exist at the nanoscale, as well as to the synthesis method thereof.

The present application relates to a kind of drug rapid detection method, equipment and medium based on photonic crystal image, comprising: image pre-processing, to locate the position of photonic crystal in image and cut image, so that only photonic crystal is left in the image after cutting;Extract the color feature vector of the photonic crystal, and carry out dimension reduction processing;The color feature vector after dimension reduction is converted, identified and compared based on support vector machine, and the drug identification of the to-be-measured body fluid is completed.The present application is based on the color difference of different drugs and photonic crystal after reaction, judges what kind of drug, such as amphetamine, pseudoephedrine, chloroephedrine, methylcathinone or methamphetamine, contained in the to-be-measured liquid by comparing with standard spectrum, fast, low cost, mass detection, low equipment cost.

This invention belongs to the field of biomedicine and discloses for the first time the application of sinapic acid and its derivatives, methyl myrosate and ethyl myrosate, in the prevention and / or treatment of methamphetamine addiction withdrawal. By investigating the conditional position preference behavior of methamphetamine-addicted mice and mice treated with sinapic acid, methyl myrosate, and ethyl myrosate, the inventors demonstrated that sinapic acid and its derivatives, methyl myrosate and ethyl myrosate, can reduce dependence on and cravings for methamphetamine. Therefore, sinapic acid and its derivatives, methyl myrosate and ethyl myrosate, can serve as active ingredients in the preparation of addiction treatment drugs, providing a new option for the prevention and / or treatment of methamphetamine addiction and showing promising clinical application prospects.

This invention provides a method for constructing a donor-acceptor type perylene diimide-based porous conjugated polymer probe and detecting methamphetamine and amphetamine solutions. The method synthesizes donor-acceptor type perylene diimide-based porous conjugated polymer probes with different topologies by combining an electron acceptor perylene diimide derivative and an electron donor aggregation-induced emission fluorophore via a succinate coupling reaction. When used for the detection of methamphetamine and amphetamine, this system exhibits a clear ratiometric fluorescence response, with the fluorescence color gradually changing from yellow-green to orange and orange-red, demonstrating a significant ratiometric fluorescence response. It features fast response speed, high detection sensitivity, good selectivity, and no interference from other common structurally and property-similar substances, enabling the differentiation and identification of methamphetamine and amphetamine.

The present invention discloses a kind of 7-dehydrocholesterol-perylene diimide derivative and its preparation and application of fluorescent film, and utilizes the advantages such as the rigid structure and multiple chiral centers of 7-dehydrocholesterol to connect the conjugated fluorescent molecule with high fluorescence quantum yield, perylene anhydride, through a connecting arm. The synthesized fluorescent compound is used as a sensing element to prepare a fluorescent film, which can be used to detect a variety of banned drugs such as methamphetamines, and is applied to the field of banned drug detection. The present invention is simple to operate, and the reaction conditions are mild. The prepared fluorescent sensor film has high fluorescence quantum yield, good stability, low detection limit, long service life, and high detection sensitivity. It can be applied in sensors for detecting a variety of banned drugs such as methamphetamines. This type of fluorescent sensor film is installed in a portable fluorescence detector for supporting use to achieve rapid detection of banned drugs and improve the detection efficiency of banned drugs.

The application discloses a medicine for treating or preventing methamphetamine addiction and application, and discloses a new use of an ERK inhibitor. The application studies the application of the ERK inhibitor in drug addiction, studies the inhibiting effect of GDC-0994 on treating methamphetamine addiction through a methamphetamine addiction model (including a position preference model and a self-administration experiment model), finds that the ERK inhibitor GDC-0994 can significantly reduce the seeking and intake of methamphetamine of animals, that is, the ERK inhibitor GDC-0994 can antagonize the addiction of methamphetamine, and indicates that the GDC-0994 inhibiting ERK can effectively treat the methamphetamine addiction.

The invention discloses a method for detecting methamphetamine based on a Co-AD quantum dot molecular imprinting fluorescence sensor. The method comprises the following steps: step 1, preparing Co-AD quantum dots; step 2, synthesizing a Co-AD quantum dot molecularly imprinted fluorescence sensor; 3, drawing a standard working curve of fluorescence quenching intensity-methamphetamine concentration; 4, measuring the content of methamphetamine in the sample; the Co-AD quantum dot molecularly imprinted fluorescent sensor prepared by the method combines high selectivity, simplicity, convenience and rapidness of molecularly imprinted polymer and high sensitivity of fluorescence detection, can accurately and specifically recognize methamphetamine, and is effectively applied to field rapid detection of drugs, the linear detection range of the detection method to methamphetamine is 67-469nM, and the detection method has a wide application prospect. The detection limit is as low as 23nM.

The invention discloses an antigen-coupled PVDF-PEI membrane type SERS sensor constructed based on a surface enhanced Raman scattering (SERS) technology, the antigen-coupled PVDF-PEI membrane type SERS sensor comprises two parts of a specific immune probe and an antigen-coupled PVDF-PEI composite membrane, and the preparation of the antigen-coupled PVDF-PEI membrane type SERS sensor comprises the following steps: synthesizing Au (at) 4-MBA (at) Ag NPs with a core-shell structure through gold nanoparticles (AuNPs), and coupling an METH antibody to obtain an SERS immune probe; meanwhile, a PVDF film is subjected to pretreatment, surface PEI modification and tannic acid modification to prepare a PVDF-PEI composite film, and then the PVDF-PEI composite film is coupled with an METH antigen (METH-BSA) to form the detection substrate. The prepared antigen-coupled PVDF-PEI membrane type SERS sensor can be used for ultra-trace detection of methylamphetamine (METH) and derivatives thereof in a liquid sample, has the advantages of high sensitivity, good anti-interference capability and the like, and has very huge popularization and application values.

This invention discloses a method for rapid quantitative analysis of methamphetamine based on portable near-infrared spectroscopy and PLS modeling, characterized by: (1) collecting near-infrared diffuse reflectance spectra of methamphetamine crystals and tablets using a portable near-infrared analyzer, and preprocessing the spectral data using the S-G method; (2) performing data analysis and modeling based on the PLS method to obtain a PLS regression model; (3) detecting the sample to be tested: collecting the near-infrared diffuse reflectance spectra of the sample to be tested, and then obtaining the methamphetamine content in the sample to be tested according to the model in step (2).

The invention relates to the technical field of biological medicines, in particular to application of N-acetylneuraminic acid in preparation of a medicine for treating methamphetamine addiction. The key effect of N-acetylneuraminic acid (Neu5Ac) in methamphetamine addiction treatment is found for the first time, the CPP score of a methamphetamine addiction mouse can be obviously reduced, it is proved that the N-acetylneuraminic acid (Neu5Ac) has a good treatment effect on methamphetamine addiction, and Neu5Ac can be subjected to endogenous synthesis and has the advantages of being good in biocompatibility and small in toxic and side effect.

The invention relates to the technical field of spectrum detection, in particular to a drug spectrum sealing detection device, which comprises a main shell, and can realize pure mechanical rapid switching of compensating plates aiming at spectrum interference generated by different sealing packaging materials when in use, so that the sealing performance of the drug spectrum sealing detection device is improved. The problem that spectrum signals of a sealing packaging material are overlapped with spectrum signals of drugs such as methamphetamine, ketamine and diacetylmorphine is effectively solved, interference signals are prevented from covering drug characteristic spectrum peaks, misjudgment and missed judgment of detection are prevented, the driving switching assembly is in linkage through components such as a gear column, a limiting rack and an abutting idler wheel, and the detection efficiency is improved. According to the invention, the signal acquisition function of the intelligent spectrum sensor is combined, so that the detection accuracy and reliability are greatly improved, the requirements of on-site fast detection and conventional detection are met, and the technical defect that an existing device is not provided with an effective spectrum interference compensation structure is overcome.

The invention discloses a nano drug-loading delivery system for treating methamphetamine addiction and a preparation method and a pharmaceutical preparation thereof, and belongs to the technical field of medical configuration products. According to the nano drug-loaded delivery system, exosome from HUVECs (human umbilical vein endothelial cells) engineered and modified by hypoxia pretreatment and transcription activator protein (TAT) is used as a nano carrier of cannabidiol CBD, and compared with a drug delivery mode of high-invasiveness intraventricular injection or high-dose intraperitoneal injection (40-100 mg / kg) in treatment of METH addiction at present, the nano drug-loaded delivery system has the advantages that the drug delivery efficiency is greatly improved; the nano drug-loading delivery system treats METH addiction in a nasal delivery mode, and the effective concentration of the nano drug-loading delivery system is only 2 mg / kg and is only 1 / 20 of the minimum effective concentration (40 mg / kg) of intraperitoneal injection CBD solution for treating METH addiction.

The application relates to a marker, a kit and an application for differentiating methamphetamine-induced psychosis from primary schizophrenia, and belongs to the technical field of biological medicine and judicial expertise. The application provides application of miRNA as a marker in preparation of a product for differentiating methamphetamine-induced psychosis from primary schizophrenia, wherein the miRNA comprises at least one of hsa-miR-11400, hsa-miR-1908-3p, hsa-miR-4433b-3p and nov-miR-chr20. The application takes nov-miR-chr20 as a forward specific marker of PS, and takes the other three miRNAs as forward indicating markers of MAP, effectively avoids false positive or false negative, improves the specificity and sensitivity of detection, ensures stability and repeatability, and solves the misdiagnosis problem caused by high overlap and similarity of MAP and PS.

The application provides a composite fluorescent sensing material for detecting methamphetamine, and belongs to the technical fields of fluorescent sensing materials and drug detection. The composite fluorescent sensing material is obtained by reacting a precursor molecule R1-FR2-R3 with a metal salt compound. The precursor molecule R1-FR2-R3 is synthesized from an organic ligand capable of coordinating and cross-linking with metal ions, a fluorinated benzene ring containing two aldehyde groups, and a recognition molecule capable of selectively adsorbing MAs and producing fluorescence quenching. When a fluorescent sensing film prepared by using the composite fluorescent sensing material is used for detecting methamphetamine compounds, the fluorescent sensing film has excellent selectivity and sensitivity. The method for preparing the composite fluorescent sensing material in the application can control the morphology and size of the material, so that a material structure more conducive to enriching MAs molecules can be selected and prepared.

The invention discloses a preparation method of a bromine lead deuteride methylamine perovskite single crystal, and belongs to the technical field of crystal growth. The preparation method comprises the following steps: performing multiple deuteration on bromomethylamine, performing heavy water separation and recovery on a mixed solution containing bromomethylamine and heavy water generated after each deuteration, and synthesizing a bromine lead methylamine deuteride single crystal. Bromomethylamine and heavy water are subjected to multiple times of deuteration in a certain proportion to generate bromomethylamine deuteride, then bromomethylamine deuteride and lead bromide are subjected to inverse temperature crystallization in an organic solvent, and the bromolead deuteride methylamine perovskite single crystal is synthesized. The preparation method provided by the invention has the advantages that the synthesis process is efficient, safe and controllable, heavy water can be recycled, the synthesis cost is greatly reduced, and the stability of the synthesized bromine lead deuteride methylamine perovskite single crystal is greatly improved.

The present invention relates to the field of plant nutrition, and particularly to an optimized nitrogen fertilization strategy based on soil fumigation. The present invention provides a nitrogen fertilizer application strategy based on soil fumigation, comprising the following steps: applying nitrogen fertilizer after soil fumigation; the soil fumigant comprises one or more of chloropicrin, dazomet, methamphetamine, dimethyl disulfide, horseradish, and ethionol; the fumigant dosage is divided into a low dose of 20 to 40 kg / mu and a high dose of 40 to 80 kg / mu; the nitrogen fertilizer is a combination of ammonium nitrogen and nitrate nitrogen, with 1 / 8 of the nitrogen fertilizer's mass used as a base fertilizer, and the remaining nitrogen fertilizer is applied in four equal portions as topdressing; the total amount of the base fertilizer and topdressing is 32 to 40 kg / mu; the mass ratio of ammonium nitrogen fertilizer to nitrate nitrogen fertilizer in the nitrogen fertilizer is 50 to 100:0 to 50; and the mass of ammonium nitrogen fertilizer and nitrate nitrogen fertilizer in the nitrogen fertilizer is unequal. Compared with conventional nitrogen application, this method can significantly increase crop yields.

The application belongs to the technical field of pharmaceutical analysis, and particularly relates to a detection method of ammonia in methamphetamine, which is a convenient, efficient and accurate detection method for solving the problem of ammonia detection in methamphetamine. The method uses gas chromatography to detect the content of ammonia in methamphetamine, has low detection cost, and is convenient for quality control of methamphetamine. The method is convenient, efficient and accurate, and fully meets the guiding principles of method verification of Chinese Pharmacopoeia in terms of system applicability, repeatability, specificity and accuracy, and can be used for quality control of methamphetamine.

The invention discloses a method for detecting methylamphetamine based on an EDTA-Cu quantum dot molecular imprinting fluorescent probe. The method comprises the following steps: step 1, synthesizing EDTA-Cu quantum dots; step 2, preparing an EDTA-Cu quantum dot molecular imprinting fluorescent probe; 3, drawing a standard working curve of fluorescence intensity change ratio-phenylamphetamine concentration; and 4, measuring the content of methylamphetamine in the sample. The EDTA-Cu quantum dot molecularly imprinted fluorescent probe prepared by the invention has high selectivity of a molecularly imprinted polymer, simplicity and convenience in operation and high sensitivity of fluorescence detection, can realize specific recognition and quantitative detection of trace methamphetamine in artificial urine, and is suitable for on-site rapid detection of drugs. According to the detection method, the linear detection range of methylamphetamine is 53-371 nM (the correlation coefficient R is equal to 0.9925), and the detection limit is as low as 20.6 nM.

Styrene compounds, methods for preparing the same, and uses thereof in the preparation of medicaments for treating drug addiction and alleviating withdrawal symptoms. Disclosed are styrene compounds having the structure of Formula III: or stereoisomers, deuterated compounds, or pharmaceutically acceptable salts thereof, wherein R 1 , R 2 , R 3 are each independently selected from hydrogen, hydroxyl, alkoxy, or phosphate; L is selected from carbonyl or methylene; X is selected from O; R 4 is selected from hydrogen, C1-C 10 linear or branched alkyl, C3-C 10 cycloalkyl, aralkyl, hydroxyalkyl, or carbonylalkyl. The styrene compounds of the present invention not only intervene in METH-induced reward behavior, but also improve negative emotional behaviors such as depression and anxiety commonly seen during withdrawal, and have a dual value of significantly alleviating both addiction symptom formation and withdrawal symptoms. Disclosed are uses of the styrene compounds or stereoisomers, deuterated compounds, or pharmaceutically acceptable salts thereof in the preparation of medicaments for preventing and / or treating methamphetamine addiction and alleviating depression and anxiety-like behaviors caused by methamphetamine withdrawal.

The present invention discloses the use of Klebsiella oxytoca. The present invention provides the use of Klebsiella oxytoca in the preparation of a medicament for reducing latent psychological craving after methamphetamine addiction and / or treating methamphetamine addiction. The Klebsiella oxytoca of the present invention can reduce methamphetamine craving. Experiments have shown that it can significantly inhibit latent psychological craving in rats 30 days after abstinence following methamphetamine self-administration training. The present invention regulates the composition of the intestinal flora after addiction by gavage, gradually reducing addicts' craving for drugs and effectively improving drug abstinence rates.

The present invention relates to an application of primers for detecting tRF expression in tissues in preparing a methamphetamine addiction auxiliary diagnostic kit. The primers are characterized in that the nucleotide sequence of tRF-1_32-Gly-GCC-2-M2 is shown in SEQ ID NO: 1, and the expression of tRF-1_32-Gly-GCC-2-M2 is specifically downregulated in the tissues of methamphetamine-addicted rats. The primers are: F1: 5'GATCGCATGGGTGGTTCAGT 3'; R1: 5'CTCTTCCGATCTAGGCGAGAAT 3'. Compared with the prior art, the present invention has the advantage that the specifically downregulated expression of tRF-1_32-Gly-GCC-2-M2 in the tissues of methamphetamine-addicted rats can be used as a novel molecular marker for diagnosing methamphetamine addiction.

This invention provides a donor-acceptor type perylene diimide-based porous conjugated polymer sensing membrane for distinguishing between methamphetamine and amphetamine atmospheres. The membrane is prepared by spin-coating a homogeneous mixture of the donor-acceptor type perylene diimide porous conjugated polymer, polystyrene, and a solvent. When used for the detection of methamphetamine and amphetamine atmospheres, the system exhibits a significant differential ratio fluorescence response, achieving quantitative and differential detection of methamphetamine and amphetamine atmospheres in the ranges of 0-600 ppm and 0-1500 ppm, respectively. It offers advantages such as fast response, simple detection process, high sensitivity, and good selectivity, without interference from other common structurally and property-similar substances. This provides a research solution for the on-site identification and differentiation of hazardous chemicals with similar structures and properties.

The invention discloses a medicine for treating and / or preventing methylamphetamine addiction, and belongs to the technical field of medicines. According to the invention, the effect of 4-(di (1H-indole-3-yl) methyl) phenol (DIM-C-pPhOH) in treating and / or preventing methamphetamine addiction is found for the first time; the 4-(di (1H-indole-3-yl) methyl) phenol has a synergistic inhibition effect on target-oriented and habitualized drug foraging reactions, can intervene different neural circuits of addiction memory at the same time, and has a more comprehensive and more stable relapse prevention effect; the invention provides a new candidate drug 4-(di (1H-indole-3-yl) methyl) phenol for treating and / or preventing methamphetamine addiction, and contributes to early solving the problems of difficult withdrawal and easy relapse of methamphetamine addiction and eliminating the harm of methamphetamine addiction to body health and social safety and stability.

This application relates to the field of biomedical technology, and in particular to the application of N-acetylneuraminic acid in the preparation of drugs for treating methamphetamine addiction. This application is the first to discover the key role of N-acetylneuraminic acid (Neu5Ac) in the treatment of methamphetamine addiction, which can significantly reduce the CPP score in methamphetamine-addicted mice, demonstrating a good therapeutic effect on methamphetamine addiction. Furthermore, Neu5Ac can be synthesized endogenously, exhibiting advantages such as good biocompatibility and low toxicity.

According to the withdrawal stage neural recovery brain network prediction method and system for methylamphetamine disorder, time sequence function connection and withdrawal stage dynamic recovery process are combined for the first time through dynamic network modeling, the limitation of traditional static analysis is broken through, dynamic characteristics of withdrawal stage neural recovery are disclosed, and the prediction method and system for the withdrawal stage neural recovery brain network of methylamphetamine disorder are provided. The positive network is mainly based on sensory motor-cerebellar connection, and the negative network relates to default mode network interaction, provides quantifiable neural markers to reveal cortical region composition of the withdrawal network, provides neural targets for clinical intervention and strength values of the withdrawal network during different withdrawal periods, evaluates recovery conditions, and provides quantitative neural markers for clinical intervention. And making of an individual rehabilitation plan is assisted.

The invention discloses a synthetic route based on methamphetamine impurity index analysis and a method for evaluating mutual relevance of methamphetamine impurity indexes, which is characterized by comprising the following steps of: enriching MA low-content impurities by adopting a microcirculation solid-phase microextraction technology, and analyzing 22 characteristic target substances in illegal MA products by utilizing ultra-high performance liquid chromatography-tandem mass spectrometry. And deducing a synthetic route by taking an alkaloid peak area as a related calculation data variable. By analyzing the synthetic route and the correlation, the current MA selling network / source and MA manufacturing process can be identified and fed back to an investigation department in time. Therefore, targeted reference is provided for formulating policies for fighting against MA crimes, and technical support is also provided for construction of political and law intelligence and criminal technology innovation systems.

The invention discloses an application of ethyl pyruvate in preparation of a medicine for treating or preventing methamphetamine addiction, belongs to the technical field of medicines, and provides an application of ethyl pyruvate in preparation of a medicine for treating or preventing methamphetamine addiction. According to the present invention, by inhibiting the HMGB1-TLR4-MyD88-PI3K-AKT-NF-KB signal channel, the ethyl pyruvate can reduce the neuroinflammation reaction, and can significantly reduce the addiction behavior and the nerve injury caused by the methamphetamine, such that the new treatment strategy is provided for the treatment of the methamphetamine addiction, and the wide clinical application prospect is provided. Ethyl pyruvate has an obvious nerve protection effect and can relieve nerve injury and promote nerve repair.