Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

24 results about "C2C12" patented technology

C2C12 is an immortalized mouse myoblast cell line. The C2C12 cell line is a subclone of myoblasts that were originally obtained by Yaffe and Saxel at the Weizmann Institute of Science in Israel in 1977. Developed for in vitro studies of myoblasts isolated from the complex interactions of in vivo conditions, C2C12 cells are useful in biomedical research. These cells are capable of rapid proliferation under high serum conditions and differentiation into myoblasts under low serum conditions. Mononucleated myoblasts can later fuse to form multinucleated myotubes under low serum conditions or starvation, leading to the precursors of contractile skeletal muscle cells in the process of myogenesis. C2C12 cells are used to study the differentiation of myoblasts, osteoblasts, and myogenesis, to express various target proteins, and to explore mechanistic biochemical pathways.

Application of phytobacterium plantarum Lp-G18 in preparation of medicine for preventing and / or treating skeletal muscle atrophy

PendingCN120899769AMuscular disorderUnknown materialsDexamethasoneSkeletal muscle atrophy
The invention provides application of lactobacillus plantarum Lp-G18 in preparation of a medicine for preventing and / or treating skeletal muscle atrophy, and belongs to the technical field of biological medicines. The invention further provides a preparation method of the lactobacillus plantarum Lp-G18 for preventing and / or treating skeletal muscle atrophy. According to the invention, a dexamethasone (DEX)-induced C2C12 amyotrophy cell model is taken as an experimental subject to evaluate the efficacy of the phytobacterium plantarum strain Lp-G18 in the aspect of skeletal amyotrophy treatment, and the phytobacterium plantarum strain Lp-G18 has a remarkable improvement effect on DEX-induced myotube diameter reduction, fusion index reduction, protein content reduction and myotube length shortening. Therefore, the lactobacillus plantarum strain Lp-G18 can be applied to prevention and / or treatment of skeletal muscle atrophy and can be used as an active component to develop and prepare related medicines.
Owner:BIOGROWING CO LTD

Application of oridonin in the preparation of agents to improve muscle function

This invention relates to the application of oridonin in the preparation of agents that improve muscle function, specifically by improving skeletal muscle dysfunction, enhancing insulin sensitivity, promoting myoblast differentiation into myotube cells, and / or increasing myoblast insulin sensitivity. Using an in vitro C2C12 myoblast model, this invention demonstrates that oridonin can promote myoblast differentiation and growth and increase C2C12 myoblast insulin sensitivity. Through an obesity-induced skeletal muscle dysfunction model, it is demonstrated that oridonin can improve skeletal muscle dysfunction and insulin resistance by increasing muscle strength, muscle endurance, muscle mass, and reducing muscle lipid accumulation. This invention provides new insights for drug research on improving skeletal muscle dysfunction and enhancing insulin sensitivity, and also enriches the pharmacological system of oridonin.
Owner:INSTITUTE OF CHINESE MATERIA MEDICA CHINA ACADEMY OF CHINESE MEDICAL SCIENCES +1

YL1-tiRNA for promoting mouse muscle cell injury repair

A YL1-tiRNA for promoting mouse muscle cell injury repair belongs to the technical field of molecular biology, the YL1-tiRNA is formed by cutting mature mt-Tv, a phosphate group is added at the 5th terminal, phosphorylation modification is carried out on the sequence, and a section of sequence is added at the 5th terminal without changing the function of the sequence, the YL1-tiRNA is characterized in that the nucleotide sequence of the YL1-tiRNA is shown as Seq ID No: 1, and the nucleotide sequence of the YL1-tiRNA is shown as Seq ID No: 1. Experiments prove that the YL1-tiRNA can promote mouse muscle injury repair by regulating proliferation of C2C12 cells.
Owner:QIQIHAR UNIVERSITY

Application of glutamic acid and alpha-KG in promoting differentiation and fusion of skeletal muscle myoblasts

The invention discloses application of glutamic acid and alpha-KG in promoting differentiation and fusion of skeletal muscle myoblasts. In particular discloses application of glutamic acid and / or alpha-ketoglutaric acid in promoting myoblast fusion. The invention also discloses a method for promoting myoblast fusion. The method comprises the step of contacting myoblasts with glutamic acid and / or alpha-ketoglutaric acid. It is found for the first time that glutamic acid and alpha-KG have the effect of promoting myoblast differentiation and / or fusion, and glutamic acid and alpha-KG can be prepared into feed, feed additives, myoblast fusion promoters and other products to be used for promoting animal muscle development and breeding high-yield and high-quality meat animal products. Experiments show that by adding a proper amount of glutamic acid and alpha-KG in the muscle cell differentiation process, the fusion rate of mouse C2C12 cells and sheep skeletal muscle myoblasts can be remarkably increased, the number of formed myotubes is increased, and the differentiation level of the two cells is promoted. The method has a wide application prospect in the fields of livestock breeding and the like.
Owner:CHINA AGRI UNIV

Composition for strengthening muscle strength or preventing, ameliorating or treating muscle loss comprising lilium lancifolium extract as active ingredient

The present invention relates to a composition for strengthening muscle strength or preventing, ameliorating or treating muscle loss, comprising a Lilium lancifolium extract as an active ingredient. Specifically, when C2C12 cells were pre-treated with a Lilium lancifolium extract, and then treated with H2O2, dexamethasone, or TNF-α, muscle damage was alleviated and muscle loss was inhibited, and the muscle mass and grip strength decreased by dexamethasone administration in a muscle atrophy mouse model were increased upon administration of the Lilium lancifolium extract. Therefore, the composition can be effectively used as a health functional food, medicine or feed additive for strengthening muscle strength or preventing, ameliorating or treating muscle loss.
Owner:KOREA INST OF ORIENTAL MEDICINE

Application of reagent for promoting expression of miR-15b-5p in preparation of medicine for promoting muscle injury repair

PendingCN121943943Apromote proliferationInhibit inflammationOrganic active ingredientsAntipyreticNucleotideMuscle injury
The invention belongs to the technical field of biological medicines, and particularly relates to application of a reagent for promoting expression of miR-15b-5p in preparation of a medicine for promoting muscle injury repair, the nucleotide sequence of the miR-15b-5p is TAGCAGCACATCGGTTTACA, and the nucleotide sequence is marked as SEQ ID NO.1. The invention also relates to application of the reagent for promoting expression of the miR-15b-5p in preparation of a medicine for promoting muscle injury repair. Through miR-15b-5p overexpression and knock-down experiments, the overexpression of the miR-15b-5p can extremely remarkably inhibit the expression of a proliferation gene of a C2C12 cell and extremely remarkably inhibit the cell activity, the miR-15b-5p can promote the apoptosis of the C2C12 cell, and meanwhile, the overexpression of the miR-15b-5p can promote the differentiation of the C2C12 cell.
Owner:SICHUAN AGRI UNIV

Application of deaminotyrosine in improvement or prevention and treatment of muscle atrophy

The invention discloses application of deaminotyrosine in improvement or prevention and treatment of muscular atrophy, and relates to the technical field of biological medicines. The invention finds that in the cellular level, DAT can effectively resist C2C12 myoblast senescence induced by etoposide; in a dexamethasone-induced C2C12 myotube atrophy model, DAT not only inhibits myotube diameter reduction from the form, but also down-regulates mRNA expression of key atrophy genes Atrogin-1 and MuRF-1 from the molecular level, and inhibits excessive activation of a ubiquitin-proteasome system; in-vivo animal experiments prove that DAT can reverse aging-related dyskinesia of rapidly-aged SAMP8 mice, and gait parameters of the rapidly-aged SAMP8 mice are all remarkably improved. According to the invention, a complete evidence chain from cells to the whole is constructed, and the DAT is proved to improve the senescent skeletal muscle atrophy through multiple ways of intervening cell senescence, antagonizing protein degradation, improving muscle microenvironment and the like, and shows important potential application value.
Owner:TAIHE HOSPITAL OF SHIYAN CITY (AFFILIATED HOSPITAL OF HUBEI UNIVERSITY OF MEDECINE)

A soy dregs solid fermentation preparation and its application in treating or preventing sarcopenia

The present invention discloses a bean dregs solid-state fermentation preparation and its application in treating or preventing sarcopenia, relates to the field of bean dregs processing, wherein the bean dregs solid-state fermentation preparation is based on Lactobacillus paracasei LMX1 and Pediococcus acidilactici IFJ1 as fermentation strains, bean dregs as fermentation substrate, first by solid-state fermentation, and then by extraction. The present invention establishes a myotube atrophy model by inducing mouse myoblast C2C12 damage with TNF‑α in vitro, explores the effect of the bean dregs solid-state fermentation preparation on C2C12 cells, and studies the effect of the bean dregs solid-state fermentation preparation on LPS-induced muscle atrophy mice in vivo. The results show that the bean dregs solid-state fermentation preparation has the potential to delay aging, prevent muscle atrophy and weakness associated with aging, and treat sarcopenia, providing a reference for exploring the potential application of plant active ingredients in preventing or treating muscle function.
Owner:INST AGRO PROD PROCESSING ANHUI ACADEMY AGRI SCI

Method for constructing mouse TGIF1 gene knockout cell line based on CRISPR / Cas9 technology

The invention provides a method for constructing a mouse TGIF1 gene knockout cell line based on a CRISPR / Cas9 technology, and belongs to the technical field of gene editing. According to the invention, the CRISPR / Cas9 technology is adopted, the TGIF1 gene in the C2C12 cell is successfully knocked out, the C2C12 cell line with the knocked-out TGIF1 gene is established, the cell line is stable in heredity, and the cell morphology and proliferation are not obviously different from those of a control group cell. The method can be used for researching the function of the TGIF1 gene in mouse muscle development and revealing the action mechanism of the TGIF1 gene in muscle development regulation.
Owner:NANJING AGRICULTURAL UNIVERSITY

Composition comprising sialyloligosaccharide and n-acetylmannosamine for treating GNE myopathy and method of using same

The present invention relates to a composition comprising sialyloligosaccharide and N-acetylmannosamine for the treatment of GNE myopathy, and a method of using same. Despite ManNac exhibiting non-significant sialylation activity in GNE knockdown (GNE KD) C2C12 skeletal muscle cells, it was confirmed that co-administration of ManNac and sialyloligosaccharide promotes sialylation more effectively than single administration, thereby exhibiting an excellent synergistic effect. Such effects have also been confirmed in an animal model of GNE myopathy, and thus the combined therapy of ManNAc and sialyloligosaccharide of the present invention is expected to be advantageously employed as a novel therapeutic approach capable of overcoming hyposialylation caused by sialic acid deficiency in GNE myopathy.
Owner:NEURAGENE INC +2

Composition for preventing, alleviating, or treating muscle diseases, comprising NFAT inhibitor as active ingredient

The present invention relates to a composition for preventing, alleviating, or treating muscle diseases, the composition comprising an NFAT inhibitor as an active ingredient. An NFAT inhibitor (VIVIT peptide) comprising the amino acid sequence of SEQ ID NO: 1 according to the present invention was found to: alleviate the inhibition of muscle differentiation by suppressing NFAT signaling pathway activation induced by excessive calcium exposure, and increase the expression levels of muscle differentiation-related proteins in C2C12 myoblasts and mouse muscle-derived myoblasts. Thus, the NFAT inhibitor can be effectively used as a composition for preventing, alleviating, or treating muscle diseases.
Owner:THE IND & ACADEMIC COOP IN CHUNGNAM NAT UNIV (IAC)

Adeno-associated viral vectors expressing microdystrophin genes and uses thereof

The application discloses an adeno-associated virus vector expressing a micro anti-dystrophin gene and application thereof. A human micro anti-dystrophin has an amino acid sequence shown as SEQ ID NO. 1. A gene encoding the human micro anti-dystrophin has a sequence shown as SEQ ID NO. 3. On this basis, a muscle tissue-specific promoter is used to efficiently produce the micro anti-dystrophin in C2C12 muscle cells. Finally, an AAV9 virus vector and a recombinant adeno-associated virus expressing the micro anti-dystrophin are constructed, the AAV9 virus vector and the recombinant adeno-associated virus can efficiently transduce muscle cells in a DMD disease model, and the micro anti-dystrophin can be efficiently expressed to realize the goal of DMD treatment.
Owner:CHENGDU GENE VECTOR BIOTECHNOLOGY CO LTD

A method for screening anti-sarcopenia components in propolis extract and its application

The present invention discloses a method for screening anti-sarcopenia components in a propolis extract and its application. The process comprises: screening target genes of the propolis extract; obtaining gene targets of sarcopenia; drawing a VENNY diagram, importing the diagram into a STRING database to obtain information on protein interactions, and importing the data obtained from the STRING database into Cytoscape 3.9.1 software to obtain the degree value of each target; enrichment analysis of target genes of PE acting on sarcopenia; molecular docking; and verifying the prediction results using a D-gal-induced C2C12 cell model. Through the method, it is found that the active ingredient in the propolis extract is apigenin, and the preventive and therapeutic effect of apigenin on sarcopenia is discovered, which provides a theoretical basis for the clinical treatment of sarcopenia.
Owner:FENYANG COLLEGE OF SHANXI MEDICAL UNIV

Composition for promoting myotube formation and maintaining muscle health

The invention discloses a composition for promoting myotube formation and maintaining muscle health. The problem that in the prior art, leucine or a simple combination of leucine and other BCAA is poor in muscle regeneration promoting effect is solved. A composition for promoting myotube formation and maintaining muscle health includes leucine, isoleucine, and alpha-ketoglutaric acid. The invention proves that the combination of the three has a remarkable combination effect in promoting myoblasts to differentiate into myotubes. The test data shows that the differentiation promoting effect of the combination of the three components is obviously better than that of any single component or double component combination, and the cell proliferation test proves that the composition has no obvious influence on the proliferation of C2C12 myoblasts and even eliminates toxic interference at high concentration. It is shown that the beneficial effect of promoting the increase of myotube number is specifically achieved by enhancing the differentiation process of cells rather than simple proliferation promoting action and pointing to more mature muscle function formation, and therefore the composition can be applied to the situation that muscle regeneration needs to be promoted, and muscle atrophy is improved or prevented.
Owner:SHANGHAI YUANZHIJIANKANG DIGITAL TECHNOLOGY CO LTD

Traditional Chinese medicine composition for enhancing functions of mature skeletal muscle cells and application

The invention discloses a traditional Chinese medicine composition for enhancing functions of mature skeletal muscle cells and application of the traditional Chinese medicine composition. The composition is prepared from ginseng, astragalus membranaceus, pericarpium citri reticulatae, dogwood and rhizoma polygonati according to a specific ratio. The invention also provides an establishment method based on the quality standard of various active components (ginsenoside Rg1, hesperidin and the like) in the composition. The traditional Chinese medicine composition disclosed by the invention does not have a remarkable activity promoting effect on undifferentiated C2C12 myoblasts in a proliferation period, but can specifically enhance the cell activity of differentiated mature C2C12 myotubular cells. The action characteristics of the cell state dependence show that the composition does not simply stimulate cell proliferation, but is targeted to improve the functional state of mature muscle cells, so that a high-precision solution is provided for treating diseases (such as sarcopenia) characterized by mature muscle fiber function decline.
Owner:LONGHUA HOSPITAL SHANGHAI UNIV OF TRADITIONAL CHINESE MEDICINE

Application of FNDC1 protein in promoting skeletal muscle regeneration and treating muscle development-related diseases

This invention discloses the use of FNDC1 protein to promote skeletal muscle regeneration and treat muscle development-related diseases. Researchers found that when C2C12 cells were treated with FNDC1 protein, the ability of myotubes to fusion increased with increasing concentrations of the recombinant FNDC1 protein, indicating that FNDC1 protein can promote myogenic differentiation. Furthermore, treatment of CTX mice with FNDC1 protein revealed that it promoted muscle regeneration. This suggests that FNDC1 protein can be used to prepare drugs and feeds for treating skeletal muscle dysplasia.
Owner:NORTHWEST A & F UNIV

Enhancer for inhibiting C2C12 cell differentiation and application thereof

The invention discloses an enhancer for inhibiting C2C12 cell differentiation, the enhancer inhibits C2C12 cell differentiation by regulating and controlling Lmod2 gene expression, the enhancer is an LSE1 or LSE2 enhancer, the LSE1 enhancer is located at the 28906476-28906976bp position of the sixth chromosome of a mouse reference genome mm10, and the LSE2 enhancer is located at the 28479380-28480254bp position of the sixth chromosome of the mouse reference genome mm10. Through knockout of the enhancer LSE1 or LSE2 or simultaneous knockout of the enhancer LSE1 and LSE2, differentiation of C2C12 cells can be effectively inhibited, muscle differentiation can be further regulated and controlled, an important functional model and a theoretical basis are provided for deep analysis of a molecular mechanism of regulation and control of muscle differentiation and regeneration by the enhancer, and a new method and strategy are provided for research of muscle differentiation and development.
Owner:QINGDAO AGRI UNIV +1

Composition for preventing, alleviating or treating sarcopenia, comprising plantago asiatica extract as active ingredient

The present invention relates to a composition for preventing, alleviating or treating sarcopenia, comprising a Plantago asiatica extract as an active ingredient. The Plantago asiatica extract of the present invention has no C2C12 cytotoxicity, has an effect in alleviating muscle loss in a cell experimental model through inhibition of muscle cell differentiation, and has an effect on muscle loss by alleviating skeletal muscle loss in a cachexia-induced muscle loss animal model.
Owner:KOREA INST OF ORIENTAL MEDICINE

Use of timosaponin A-III in preparation of a drug for treating sarcopenia

This invention discloses the application of Anemarrhena saponin A-III in the preparation of drugs for treating sarcopenia. This invention is the first to discover that Anemarrhena saponin A-III can significantly promote the growth of C2C12 myocytes into myotubes, improve autophagy function, and reduce lipid deposition; it can strengthen muscle function, alleviate the morphology of the gastrocnemius muscle in sarcopenia model mice, and increase muscle fiber area, thereby effectively combating sarcopenia. This provides an effective approach for the treatment of sarcopenia.
Owner:ZHEJIANG ACAD OF TRADITIONAL CHINESE MEDICINE

Natural compound for inhibiting disulfide death by taking VAV3 as target spot and application of natural compound

The invention discloses a natural compound for inhibiting disulfide death by taking VAV3 as a target spot and application of the natural compound. Belongs to the technical field of biological medicine and pharmacy. According to the invention, through virtual screening and surface plasmon resonance technologies, seven small molecular compounds, including kaempferol, liensinine, sophocarpidine, isorhamnetin, deoxyshikonin, harmine and potenoside, which can be specifically bound with VAV3 protein are screened from a natural product library for the first time. In a C2C12 cell insulin resistance model, the compounds can significantly reduce the cell death rate caused by disulfide death, and the action mechanism of the compounds is to improve the activity or expression of VAV3, inhibit abnormal accumulation of cystine and improve the NADPH level, thereby effectively preventing disulfide bond crosslinking and collapse of an actin filament network. Experiments show that the compound provided by the invention can effectively inhibit disulfide death of skeletal muscle cells by targeting VAV3, and a new lead compound and a solution are provided for developing drugs for treating diabetic muscle dysfunction and related metabolic diseases.
Owner:BEIJING UNIV OF CHINESE MEDICINE

Use of a traditional Chinese medicine composition in the preparation of a medicament for treating sarcopenia

This invention discloses the application of a traditional Chinese medicine composition in the preparation of a drug for treating sarcopenia, wherein the traditional Chinese medicine composition consists of Astragalus membranaceus and Anemarrhena asphodeloides. The study found that the combination of Astragalus membranaceus and Anemarrhena asphodeloides can significantly improve the differentiation function of C2C12 myoblasts induced by high glucose and inhibit lipid deposition, and improve skeletal muscle mass, muscle strength, and motor function in a streptozotocin-induced C57BL / 6 diabetic sarcopenia mouse model. In vitro and in vivo experiments have confirmed that this drug has significant effects in improving muscle atrophy, enhancing motor function, and restoring muscle strength; it can effectively increase the cross-sectional area of ​​muscle fibers, promote myotube fusion, and accelerate damage repair, showing a clear potential to inhibit diabetic muscle atrophy. This provides an effective traditional Chinese medicine compound intervention strategy for the clinical treatment of diabetic sarcopenia and has good prospects for development and application.
Owner:ZHEJIANG ACAD OF TRADITIONAL CHINESE MEDICINE

A chitin nanocrystal multi-level oriented muscle repair scaffold and its preparation method

This invention relates to the field of tissue engineering technology and discloses a multi-level oriented muscle repair scaffold made from chitin nanocrystals and its preparation method. The invention uses chitin derived from shrimp and crab shells as raw material to prepare chitin nanocrystals. Through steps such as preparing an aqueous suspension of chitin nanocrystals, ultrasonic dispersion, directional freezing to induce ice crystal orientation growth, freeze-drying to control ice crystal sublimation, and glutaraldehyde cross-linking fixation, a multi-level oriented scaffold with a macroscopic oriented pore structure and a microscopic oriented micro / nanofiber structure is prepared, with the chitin nanocrystals arranged along the orientation pore direction. This scaffold has a high specific surface area, can promote the orientation alignment and myogenic differentiation of C2C12 cells, and can be effectively used for the repair of volumetric muscle tissue loss. Furthermore, the preparation method is simple, requires low-end equipment, is inexpensive, and can be mass-produced.
Owner:ZUNYI MEDICAL UNIV ZHUHAI CAMPUS

Luparol as an inhibitor of MSTN and its use in the preparation of products for improving or preventing muscle atrophy

PendingCN122624494AMyostatinDecreased muscle function
The application discloses a lupine alcohol as an MSTN inhibitor and application thereof in preparing products for improving or preventing and treating muscle atrophy, and belongs to the technical field of biological medicine. The application first discovers that the lupine alcohol can be used as a small molecule inhibitor of myostatin (MSTN); in-vitro cell experiments prove that the lupine alcohol can effectively antagonize the proliferation inhibition and differentiation inhibition of C2C12 myoblasts by MSTN, and block the MSTN / Smad signal pathway. In-vivo animal experiments further prove that in a muscle injury model induced by barium chloride (BaCl2), the lupine alcohol can promote skeletal muscle regeneration; in a muscle atrophy model induced by dexamethasone (DEX), the lupine alcohol can effectively relieve the decrease of muscle function and muscle fiber atrophy. The application provides a new, safe and effective natural candidate molecule for improving and / or preventing and treating muscle atrophy, especially senile muscle atrophy, and can be used for preparing medicines, health products, functional foods or dietary supplements, and has a wide application prospect.
Owner:GUANGXI UNIV

Application of ADA2 as sarcopenia treatment target

The invention discloses application of ADA2 as a sarcopenia treatment target, and belongs to the field of sarcopenia treatment. Real-time fluorescent quantitative PCR detection shows that the expression of ADA2 in the old zebra fish is increased. Further researches find that the expression of amyotrophy factors Atrogin-1 and MuRF-1 in ADA2 knockout juvenile zebrafish is reduced, the expression of ADA2 in human aging macrophages is increased, the expression of the amyotrophy factors Atrogin-1 and MuRF-1 can be increased when rhADA2 acts on C2C12 myotubes, siADA2 acts on the aging macrophages, and the expression of the amyotrophy factors Atrogin-1 and MuRF-1 can be reduced when cell supernatant and C2C12 differentiated mature myotubes are co-cultured. Therefore, it is analyzed that ADA2 can be used as a new target for treating sarcopenia, a powerful basis is provided for clinical prediction and diagnosis of patients with sarcopenia, and a treatment reference value is provided.
Owner:ZHONGDA HOSPITAL SOUTHEAST UNIV