14 results about "C2C12" patented technology

This invention relates to the application of oridonin in the preparation of agents that improve muscle function, specifically by improving skeletal muscle dysfunction, enhancing insulin sensitivity, promoting myoblast differentiation into myotube cells, and / or increasing myoblast insulin sensitivity. Using an in vitro C2C12 myoblast model, this invention demonstrates that oridonin can promote myoblast differentiation and growth and increase C2C12 myoblast insulin sensitivity. Through an obesity-induced skeletal muscle dysfunction model, it is demonstrated that oridonin can improve skeletal muscle dysfunction and insulin resistance by increasing muscle strength, muscle endurance, muscle mass, and reducing muscle lipid accumulation. This invention provides new insights for drug research on improving skeletal muscle dysfunction and enhancing insulin sensitivity, and also enriches the pharmacological system of oridonin.

A YL1-tiRNA for promoting mouse muscle cell injury repair belongs to the technical field of molecular biology, the YL1-tiRNA is formed by cutting mature mt-Tv, a phosphate group is added at the 5th terminal, phosphorylation modification is carried out on the sequence, and a section of sequence is added at the 5th terminal without changing the function of the sequence, the YL1-tiRNA is characterized in that the nucleotide sequence of the YL1-tiRNA is shown as Seq ID No: 1, and the nucleotide sequence of the YL1-tiRNA is shown as Seq ID No: 1. Experiments prove that the YL1-tiRNA can promote mouse muscle injury repair by regulating proliferation of C2C12 cells.

The invention belongs to the technical field of biological medicines, and particularly relates to application of a reagent for promoting expression of miR-15b-5p in preparation of a medicine for promoting muscle injury repair, the nucleotide sequence of the miR-15b-5p is TAGCAGCACATCGGTTTACA, and the nucleotide sequence is marked as SEQ ID NO.1. The invention also relates to application of the reagent for promoting expression of the miR-15b-5p in preparation of a medicine for promoting muscle injury repair. Through miR-15b-5p overexpression and knock-down experiments, the overexpression of the miR-15b-5p can extremely remarkably inhibit the expression of a proliferation gene of a C2C12 cell and extremely remarkably inhibit the cell activity, the miR-15b-5p can promote the apoptosis of the C2C12 cell, and meanwhile, the overexpression of the miR-15b-5p can promote the differentiation of the C2C12 cell.

The invention discloses application of deaminotyrosine in improvement or prevention and treatment of muscular atrophy, and relates to the technical field of biological medicines. The invention finds that in the cellular level, DAT can effectively resist C2C12 myoblast senescence induced by etoposide; in a dexamethasone-induced C2C12 myotube atrophy model, DAT not only inhibits myotube diameter reduction from the form, but also down-regulates mRNA expression of key atrophy genes Atrogin-1 and MuRF-1 from the molecular level, and inhibits excessive activation of a ubiquitin-proteasome system; in-vivo animal experiments prove that DAT can reverse aging-related dyskinesia of rapidly-aged SAMP8 mice, and gait parameters of the rapidly-aged SAMP8 mice are all remarkably improved. According to the invention, a complete evidence chain from cells to the whole is constructed, and the DAT is proved to improve the senescent skeletal muscle atrophy through multiple ways of intervening cell senescence, antagonizing protein degradation, improving muscle microenvironment and the like, and shows important potential application value.

The invention provides a method for constructing a mouse TGIF1 gene knockout cell line based on a CRISPR / Cas9 technology, and belongs to the technical field of gene editing. According to the invention, the CRISPR / Cas9 technology is adopted, the TGIF1 gene in the C2C12 cell is successfully knocked out, the C2C12 cell line with the knocked-out TGIF1 gene is established, the cell line is stable in heredity, and the cell morphology and proliferation are not obviously different from those of a control group cell. The method can be used for researching the function of the TGIF1 gene in mouse muscle development and revealing the action mechanism of the TGIF1 gene in muscle development regulation.

The present invention relates to a composition comprising sialyloligosaccharide and N-acetylmannosamine for the treatment of GNE myopathy, and a method of using same. Despite ManNac exhibiting non-significant sialylation activity in GNE knockdown (GNE KD) C2C12 skeletal muscle cells, it was confirmed that co-administration of ManNac and sialyloligosaccharide promotes sialylation more effectively than single administration, thereby exhibiting an excellent synergistic effect. Such effects have also been confirmed in an animal model of GNE myopathy, and thus the combined therapy of ManNAc and sialyloligosaccharide of the present invention is expected to be advantageously employed as a novel therapeutic approach capable of overcoming hyposialylation caused by sialic acid deficiency in GNE myopathy.

The present invention relates to a composition for preventing, alleviating, or treating muscle diseases, the composition comprising an NFAT inhibitor as an active ingredient. An NFAT inhibitor (VIVIT peptide) comprising the amino acid sequence of SEQ ID NO: 1 according to the present invention was found to: alleviate the inhibition of muscle differentiation by suppressing NFAT signaling pathway activation induced by excessive calcium exposure, and increase the expression levels of muscle differentiation-related proteins in C2C12 myoblasts and mouse muscle-derived myoblasts. Thus, the NFAT inhibitor can be effectively used as a composition for preventing, alleviating, or treating muscle diseases.

The invention discloses a composition for promoting myotube formation and maintaining muscle health. The problem that in the prior art, leucine or a simple combination of leucine and other BCAA is poor in muscle regeneration promoting effect is solved. A composition for promoting myotube formation and maintaining muscle health includes leucine, isoleucine, and alpha-ketoglutaric acid. The invention proves that the combination of the three has a remarkable combination effect in promoting myoblasts to differentiate into myotubes. The test data shows that the differentiation promoting effect of the combination of the three components is obviously better than that of any single component or double component combination, and the cell proliferation test proves that the composition has no obvious influence on the proliferation of C2C12 myoblasts and even eliminates toxic interference at high concentration. It is shown that the beneficial effect of promoting the increase of myotube number is specifically achieved by enhancing the differentiation process of cells rather than simple proliferation promoting action and pointing to more mature muscle function formation, and therefore the composition can be applied to the situation that muscle regeneration needs to be promoted, and muscle atrophy is improved or prevented.

The invention discloses a traditional Chinese medicine composition for enhancing functions of mature skeletal muscle cells and application of the traditional Chinese medicine composition. The composition is prepared from ginseng, astragalus membranaceus, pericarpium citri reticulatae, dogwood and rhizoma polygonati according to a specific ratio. The invention also provides an establishment method based on the quality standard of various active components (ginsenoside Rg1, hesperidin and the like) in the composition. The traditional Chinese medicine composition disclosed by the invention does not have a remarkable activity promoting effect on undifferentiated C2C12 myoblasts in a proliferation period, but can specifically enhance the cell activity of differentiated mature C2C12 myotubular cells. The action characteristics of the cell state dependence show that the composition does not simply stimulate cell proliferation, but is targeted to improve the functional state of mature muscle cells, so that a high-precision solution is provided for treating diseases (such as sarcopenia) characterized by mature muscle fiber function decline.

The present invention relates to a composition for preventing, alleviating or treating sarcopenia, comprising a Plantago asiatica extract as an active ingredient. The Plantago asiatica extract of the present invention has no C2C12 cytotoxicity, has an effect in alleviating muscle loss in a cell experimental model through inhibition of muscle cell differentiation, and has an effect on muscle loss by alleviating skeletal muscle loss in a cachexia-induced muscle loss animal model.

This invention discloses the application of Anemarrhena saponin A-III in the preparation of drugs for treating sarcopenia. This invention is the first to discover that Anemarrhena saponin A-III can significantly promote the growth of C2C12 myocytes into myotubes, improve autophagy function, and reduce lipid deposition; it can strengthen muscle function, alleviate the morphology of the gastrocnemius muscle in sarcopenia model mice, and increase muscle fiber area, thereby effectively combating sarcopenia. This provides an effective approach for the treatment of sarcopenia.

The invention discloses a natural compound for inhibiting disulfide death by taking VAV3 as a target spot and application of the natural compound. Belongs to the technical field of biological medicine and pharmacy. According to the invention, through virtual screening and surface plasmon resonance technologies, seven small molecular compounds, including kaempferol, liensinine, sophocarpidine, isorhamnetin, deoxyshikonin, harmine and potenoside, which can be specifically bound with VAV3 protein are screened from a natural product library for the first time. In a C2C12 cell insulin resistance model, the compounds can significantly reduce the cell death rate caused by disulfide death, and the action mechanism of the compounds is to improve the activity or expression of VAV3, inhibit abnormal accumulation of cystine and improve the NADPH level, thereby effectively preventing disulfide bond crosslinking and collapse of an actin filament network. Experiments show that the compound provided by the invention can effectively inhibit disulfide death of skeletal muscle cells by targeting VAV3, and a new lead compound and a solution are provided for developing drugs for treating diabetic muscle dysfunction and related metabolic diseases.

This invention discloses the application of a traditional Chinese medicine composition in the preparation of a drug for treating sarcopenia, wherein the traditional Chinese medicine composition consists of Astragalus membranaceus and Anemarrhena asphodeloides. The study found that the combination of Astragalus membranaceus and Anemarrhena asphodeloides can significantly improve the differentiation function of C2C12 myoblasts induced by high glucose and inhibit lipid deposition, and improve skeletal muscle mass, muscle strength, and motor function in a streptozotocin-induced C57BL / 6 diabetic sarcopenia mouse model. In vitro and in vivo experiments have confirmed that this drug has significant effects in improving muscle atrophy, enhancing motor function, and restoring muscle strength; it can effectively increase the cross-sectional area of ​​muscle fibers, promote myotube fusion, and accelerate damage repair, showing a clear potential to inhibit diabetic muscle atrophy. This provides an effective traditional Chinese medicine compound intervention strategy for the clinical treatment of diabetic sarcopenia and has good prospects for development and application.

This invention relates to the field of tissue engineering technology and discloses a multi-level oriented muscle repair scaffold made from chitin nanocrystals and its preparation method. The invention uses chitin derived from shrimp and crab shells as raw material to prepare chitin nanocrystals. Through steps such as preparing an aqueous suspension of chitin nanocrystals, ultrasonic dispersion, directional freezing to induce ice crystal orientation growth, freeze-drying to control ice crystal sublimation, and glutaraldehyde cross-linking fixation, a multi-level oriented scaffold with a macroscopic oriented pore structure and a microscopic oriented micro / nanofiber structure is prepared, with the chitin nanocrystals arranged along the orientation pore direction. This scaffold has a high specific surface area, can promote the orientation alignment and myogenic differentiation of C2C12 cells, and can be effectively used for the repair of volumetric muscle tissue loss. Furthermore, the preparation method is simple, requires low-end equipment, is inexpensive, and can be mass-produced.