34 results about "C2C12" patented technology

The invention provides application of lactobacillus plantarum Lp-G18 in preparation of a medicine for preventing and / or treating skeletal muscle atrophy, and belongs to the technical field of biological medicines. The invention further provides a preparation method of the lactobacillus plantarum Lp-G18 for preventing and / or treating skeletal muscle atrophy. According to the invention, a dexamethasone (DEX)-induced C2C12 amyotrophy cell model is taken as an experimental subject to evaluate the efficacy of the phytobacterium plantarum strain Lp-G18 in the aspect of skeletal amyotrophy treatment, and the phytobacterium plantarum strain Lp-G18 has a remarkable improvement effect on DEX-induced myotube diameter reduction, fusion index reduction, protein content reduction and myotube length shortening. Therefore, the lactobacillus plantarum strain Lp-G18 can be applied to prevention and / or treatment of skeletal muscle atrophy and can be used as an active component to develop and prepare related medicines.

The invention discloses a bean dreg solid state fermentation preparation and application thereof in treating or preventing sarcopenia, and relates to the field of bean dreg processing, the bean dreg solid state fermentation preparation is obtained by taking lactobacillus paracasei LMX1 and pediococcus acidilactici IFJ1 as fermentation strains, taking bean dregs as a fermentation substrate, firstly performing solid state fermentation and then performing extraction. A myotubular atrophy model is established by inducing mouse myoblast C2C12 injury with TNF-alpha in vitro, the effect of the bean dreg solid-state fermentation preparation on C2C12 cells is explored, the influence of the bean dreg solid-state fermentation preparation on LPS-induced muscular atrophy mice is researched in vivo, and the result shows that the bean dreg solid-state fermentation preparation has potential effects of delaying senescence, promoting growth of muscular atrophy, preventing and treating muscular atrophy. The composition has the effects of preventing muscle atrophy and weakness related to aging and treating sarcopenia, and reference is provided for exploring potential application of plant active ingredients in the aspect of preventing or treating muscle functions.

This invention relates to the application of oridonin in the preparation of agents that improve muscle function, specifically by improving skeletal muscle dysfunction, enhancing insulin sensitivity, promoting myoblast differentiation into myotube cells, and / or increasing myoblast insulin sensitivity. Using an in vitro C2C12 myoblast model, this invention demonstrates that oridonin can promote myoblast differentiation and growth and increase C2C12 myoblast insulin sensitivity. Through an obesity-induced skeletal muscle dysfunction model, it is demonstrated that oridonin can improve skeletal muscle dysfunction and insulin resistance by increasing muscle strength, muscle endurance, muscle mass, and reducing muscle lipid accumulation. This invention provides new insights for drug research on improving skeletal muscle dysfunction and enhancing insulin sensitivity, and also enriches the pharmacological system of oridonin.

A YL1-tiRNA for promoting mouse muscle cell injury repair belongs to the technical field of molecular biology, the YL1-tiRNA is formed by cutting mature mt-Tv, a phosphate group is added at the 5th terminal, phosphorylation modification is carried out on the sequence, and a section of sequence is added at the 5th terminal without changing the function of the sequence, the YL1-tiRNA is characterized in that the nucleotide sequence of the YL1-tiRNA is shown as Seq ID No: 1, and the nucleotide sequence of the YL1-tiRNA is shown as Seq ID No: 1. Experiments prove that the YL1-tiRNA can promote mouse muscle injury repair by regulating proliferation of C2C12 cells.

The invention discloses application of glutamic acid and alpha-KG in promoting differentiation and fusion of skeletal muscle myoblasts. In particular discloses application of glutamic acid and / or alpha-ketoglutaric acid in promoting myoblast fusion. The invention also discloses a method for promoting myoblast fusion. The method comprises the step of contacting myoblasts with glutamic acid and / or alpha-ketoglutaric acid. It is found for the first time that glutamic acid and alpha-KG have the effect of promoting myoblast differentiation and / or fusion, and glutamic acid and alpha-KG can be prepared into feed, feed additives, myoblast fusion promoters and other products to be used for promoting animal muscle development and breeding high-yield and high-quality meat animal products. Experiments show that by adding a proper amount of glutamic acid and alpha-KG in the muscle cell differentiation process, the fusion rate of mouse C2C12 cells and sheep skeletal muscle myoblasts can be remarkably increased, the number of formed myotubes is increased, and the differentiation level of the two cells is promoted. The method has a wide application prospect in the fields of livestock breeding and the like.

The invention belongs to the technical field of medicines, and particularly provides novel application of eugenol in preparation of products for promoting myoblast differentiation. Cell experiment evaluation proves that the eugenol can remarkably promote C2C12 myoblast differentiation and promote myotube formation, and the eugenol is mainly characterized by increasing the myotube diameter, increasing the myotube length, improving the myotube fusion index and increasing the cell total protein content. Therefore, the eugenol provided by the invention can be applied to preparation of products for promoting myoblast differentiation.

The invention discloses an HMPB / FA nano system with multienzyme activity and a preparation method of the HMPB / FA nano system, and belongs to the technical field of biological medicines. The method comprises preparation of mesoporous prussian blue PB, hollow mesoporous prussian blue HMPB and an HMPB / FA nano system with multienzyme activity, and is simple in preparation, high in synthesis efficiency, low in cost, good in repeatability and efficient in drug utilization rate. The HMPB / FA nano-system prepared by the invention takes HMPB with a hollow mesoporous structure as a carrier, ferulic acid FA is loaded by a solution impregnation method, and the HMPB / FA nano-system has good multi-enzyme activity and has no obvious cytotoxicity to C2C12 and RAW264.7 cells. The HMPB / FA nano system prepared by the invention is applied to treatment of lower limb ischemia diseases, can obviously improve related symptoms (including weight loss and blood perfusion) of lower limb ischemia, and solves the problems of various inflammatory reactions caused by lower limb ischemia, defects in the prior art and the like.

The present invention relates to a composition for strengthening muscle strength or preventing, ameliorating or treating muscle loss, comprising a Lilium lancifolium extract as an active ingredient. Specifically, when C2C12 cells were pre-treated with a Lilium lancifolium extract, and then treated with H2O2, dexamethasone, or TNF-α, muscle damage was alleviated and muscle loss was inhibited, and the muscle mass and grip strength decreased by dexamethasone administration in a muscle atrophy mouse model were increased upon administration of the Lilium lancifolium extract. Therefore, the composition can be effectively used as a health functional food, medicine or feed additive for strengthening muscle strength or preventing, ameliorating or treating muscle loss.

The invention belongs to the technical field of biological medicines, and particularly relates to application of a reagent for promoting expression of miR-15b-5p in preparation of a medicine for promoting muscle injury repair, the nucleotide sequence of the miR-15b-5p is TAGCAGCACATCGGTTTACA, and the nucleotide sequence is marked as SEQ ID NO.1. The invention also relates to application of the reagent for promoting expression of the miR-15b-5p in preparation of a medicine for promoting muscle injury repair. Through miR-15b-5p overexpression and knock-down experiments, the overexpression of the miR-15b-5p can extremely remarkably inhibit the expression of a proliferation gene of a C2C12 cell and extremely remarkably inhibit the cell activity, the miR-15b-5p can promote the apoptosis of the C2C12 cell, and meanwhile, the overexpression of the miR-15b-5p can promote the differentiation of the C2C12 cell.

The invention discloses application of deaminotyrosine in improvement or prevention and treatment of muscular atrophy, and relates to the technical field of biological medicines. The invention finds that in the cellular level, DAT can effectively resist C2C12 myoblast senescence induced by etoposide; in a dexamethasone-induced C2C12 myotube atrophy model, DAT not only inhibits myotube diameter reduction from the form, but also down-regulates mRNA expression of key atrophy genes Atrogin-1 and MuRF-1 from the molecular level, and inhibits excessive activation of a ubiquitin-proteasome system; in-vivo animal experiments prove that DAT can reverse aging-related dyskinesia of rapidly-aged SAMP8 mice, and gait parameters of the rapidly-aged SAMP8 mice are all remarkably improved. According to the invention, a complete evidence chain from cells to the whole is constructed, and the DAT is proved to improve the senescent skeletal muscle atrophy through multiple ways of intervening cell senescence, antagonizing protein degradation, improving muscle microenvironment and the like, and shows important potential application value.

The present invention discloses a bean dregs solid-state fermentation preparation and its application in treating or preventing sarcopenia, relates to the field of bean dregs processing, wherein the bean dregs solid-state fermentation preparation is based on Lactobacillus paracasei LMX1 and Pediococcus acidilactici IFJ1 as fermentation strains, bean dregs as fermentation substrate, first by solid-state fermentation, and then by extraction. The present invention establishes a myotube atrophy model by inducing mouse myoblast C2C12 damage with TNF‑α in vitro, explores the effect of the bean dregs solid-state fermentation preparation on C2C12 cells, and studies the effect of the bean dregs solid-state fermentation preparation on LPS-induced muscle atrophy mice in vivo. The results show that the bean dregs solid-state fermentation preparation has the potential to delay aging, prevent muscle atrophy and weakness associated with aging, and treat sarcopenia, providing a reference for exploring the potential application of plant active ingredients in preventing or treating muscle function.

The invention provides a method for constructing a mouse TGIF1 gene knockout cell line based on a CRISPR / Cas9 technology, and belongs to the technical field of gene editing. According to the invention, the CRISPR / Cas9 technology is adopted, the TGIF1 gene in the C2C12 cell is successfully knocked out, the C2C12 cell line with the knocked-out TGIF1 gene is established, the cell line is stable in heredity, and the cell morphology and proliferation are not obviously different from those of a control group cell. The method can be used for researching the function of the TGIF1 gene in mouse muscle development and revealing the action mechanism of the TGIF1 gene in muscle development regulation.

The present invention relates to a composition comprising sialyloligosaccharide and N-acetylmannosamine for the treatment of GNE myopathy, and a method of using same. Despite ManNac exhibiting non-significant sialylation activity in GNE knockdown (GNE KD) C2C12 skeletal muscle cells, it was confirmed that co-administration of ManNac and sialyloligosaccharide promotes sialylation more effectively than single administration, thereby exhibiting an excellent synergistic effect. Such effects have also been confirmed in an animal model of GNE myopathy, and thus the combined therapy of ManNAc and sialyloligosaccharide of the present invention is expected to be advantageously employed as a novel therapeutic approach capable of overcoming hyposialylation caused by sialic acid deficiency in GNE myopathy.

The present invention relates to a composition for preventing, alleviating, or treating muscle diseases, the composition comprising an NFAT inhibitor as an active ingredient. An NFAT inhibitor (VIVIT peptide) comprising the amino acid sequence of SEQ ID NO: 1 according to the present invention was found to: alleviate the inhibition of muscle differentiation by suppressing NFAT signaling pathway activation induced by excessive calcium exposure, and increase the expression levels of muscle differentiation-related proteins in C2C12 myoblasts and mouse muscle-derived myoblasts. Thus, the NFAT inhibitor can be effectively used as a composition for preventing, alleviating, or treating muscle diseases.

The application discloses an adeno-associated virus vector expressing a micro anti-dystrophin gene and application thereof. A human micro anti-dystrophin has an amino acid sequence shown as SEQ ID NO. 1. A gene encoding the human micro anti-dystrophin has a sequence shown as SEQ ID NO. 3. On this basis, a muscle tissue-specific promoter is used to efficiently produce the micro anti-dystrophin in C2C12 muscle cells. Finally, an AAV9 virus vector and a recombinant adeno-associated virus expressing the micro anti-dystrophin are constructed, the AAV9 virus vector and the recombinant adeno-associated virus can efficiently transduce muscle cells in a DMD disease model, and the micro anti-dystrophin can be efficiently expressed to realize the goal of DMD treatment.

The invention relates to the technical field of insulin biological detection, and discloses an in vitro activity determination method for human insulin and analogues based on mouse myoblasts C2C12, which comprises the following steps: adding human insulin DMEM-H to domesticate C2C12 cells, inducing and differentiating the C2C12 cells into myotubes, and detecting the activity of the myotubes. Then adding human insulin reference products and human insulin and analogue test products with different concentration gradients to incubate myotubes, and calculating the in-vitro biological activity of the human insulin and analogue test products by comparing glucose consumption and utilization rates and carrying out parameter fitting after incubation is finished. Compared with an existing insulin activity detection method which is long in period, high in difficulty and poor in repeatability, the method in the scheme has the advantages that the sensitivity of cells to insulin is effectively improved through domestication, and the detection period is greatly shortened; and compared with a primary adipose cell method, the operation difficulty is reduced, the repeatability is better, and the method is conveniently popularized and applied to detection of the biological activity of various insulin and analogues.

The present invention discloses a method for screening anti-sarcopenia components in a propolis extract and its application. The process comprises: screening target genes of the propolis extract; obtaining gene targets of sarcopenia; drawing a VENNY diagram, importing the diagram into a STRING database to obtain information on protein interactions, and importing the data obtained from the STRING database into Cytoscape 3.9.1 software to obtain the degree value of each target; enrichment analysis of target genes of PE acting on sarcopenia; molecular docking; and verifying the prediction results using a D-gal-induced C2C12 cell model. Through the method, it is found that the active ingredient in the propolis extract is apigenin, and the preventive and therapeutic effect of apigenin on sarcopenia is discovered, which provides a theoretical basis for the clinical treatment of sarcopenia.

The invention discloses a composition for promoting myotube formation and maintaining muscle health. The problem that in the prior art, leucine or a simple combination of leucine and other BCAA is poor in muscle regeneration promoting effect is solved. A composition for promoting myotube formation and maintaining muscle health includes leucine, isoleucine, and alpha-ketoglutaric acid. The invention proves that the combination of the three has a remarkable combination effect in promoting myoblasts to differentiate into myotubes. The test data shows that the differentiation promoting effect of the combination of the three components is obviously better than that of any single component or double component combination, and the cell proliferation test proves that the composition has no obvious influence on the proliferation of C2C12 myoblasts and even eliminates toxic interference at high concentration. It is shown that the beneficial effect of promoting the increase of myotube number is specifically achieved by enhancing the differentiation process of cells rather than simple proliferation promoting action and pointing to more mature muscle function formation, and therefore the composition can be applied to the situation that muscle regeneration needs to be promoted, and muscle atrophy is improved or prevented.

The invention discloses a traditional Chinese medicine composition for enhancing functions of mature skeletal muscle cells and application of the traditional Chinese medicine composition. The composition is prepared from ginseng, astragalus membranaceus, pericarpium citri reticulatae, dogwood and rhizoma polygonati according to a specific ratio. The invention also provides an establishment method based on the quality standard of various active components (ginsenoside Rg1, hesperidin and the like) in the composition. The traditional Chinese medicine composition disclosed by the invention does not have a remarkable activity promoting effect on undifferentiated C2C12 myoblasts in a proliferation period, but can specifically enhance the cell activity of differentiated mature C2C12 myotubular cells. The action characteristics of the cell state dependence show that the composition does not simply stimulate cell proliferation, but is targeted to improve the functional state of mature muscle cells, so that a high-precision solution is provided for treating diseases (such as sarcopenia) characterized by mature muscle fiber function decline.

This invention discloses the use of FNDC1 protein to promote skeletal muscle regeneration and treat muscle development-related diseases. Researchers found that when C2C12 cells were treated with FNDC1 protein, the ability of myotubes to fusion increased with increasing concentrations of the recombinant FNDC1 protein, indicating that FNDC1 protein can promote myogenic differentiation. Furthermore, treatment of CTX mice with FNDC1 protein revealed that it promoted muscle regeneration. This suggests that FNDC1 protein can be used to prepare drugs and feeds for treating skeletal muscle dysplasia.

The invention discloses an enhancer for inhibiting C2C12 cell differentiation, the enhancer inhibits C2C12 cell differentiation by regulating and controlling Lmod2 gene expression, the enhancer is an LSE1 or LSE2 enhancer, the LSE1 enhancer is located at the 28906476-28906976bp position of the sixth chromosome of a mouse reference genome mm10, and the LSE2 enhancer is located at the 28479380-28480254bp position of the sixth chromosome of the mouse reference genome mm10. Through knockout of the enhancer LSE1 or LSE2 or simultaneous knockout of the enhancer LSE1 and LSE2, differentiation of C2C12 cells can be effectively inhibited, muscle differentiation can be further regulated and controlled, an important functional model and a theoretical basis are provided for deep analysis of a molecular mechanism of regulation and control of muscle differentiation and regeneration by the enhancer, and a new method and strategy are provided for research of muscle differentiation and development.

The invention provides application of DYRK1B as a therapeutic target in preparation of a medicine for treating sarcopenia, and relates to the technical field of biomedicine, bispecific tyrosine phosphorylation regulatory kinase 1B (DYRK1B) is also called cerebellar related kinase (MIRK) and is one of DYRK kinase family members. It is generally expressed at a high level in skeletal muscle and testis. DYRK1B is a key regulatory factor of a signaling pathway for controlling proliferation and differentiation, thereby playing a key role in skeletal muscle differentiation, spermatogenesis and cancer. According to the application disclosed by the invention, the expression level of atrophic factors Atrogin-1 and Murf-1 in DYRK1B and C2C12 myoblasts after serum deprivation is knocked down through the expression change of the DYRK1B in gastrocnemius muscle tissues of a fasting induced mouse amyotrophy model and the expression change of the DYRK1B in the C2C12 myoblasts after serum deprivation by virtue of a specific verification method. The mouse skeletal muscle DYRK1B is overexpressed, and the exercise tolerance of the mouse is measured after fasting induction of skeletal muscle atrophy. The operation is simple and rapid, and the repeatability is good.

The present invention relates to a composition for preventing, alleviating or treating sarcopenia, comprising a Plantago asiatica extract as an active ingredient. The Plantago asiatica extract of the present invention has no C2C12 cytotoxicity, has an effect in alleviating muscle loss in a cell experimental model through inhibition of muscle cell differentiation, and has an effect on muscle loss by alleviating skeletal muscle loss in a cachexia-induced muscle loss animal model.

This invention discloses the application of Anemarrhena saponin A-III in the preparation of drugs for treating sarcopenia. This invention is the first to discover that Anemarrhena saponin A-III can significantly promote the growth of C2C12 myocytes into myotubes, improve autophagy function, and reduce lipid deposition; it can strengthen muscle function, alleviate the morphology of the gastrocnemius muscle in sarcopenia model mice, and increase muscle fiber area, thereby effectively combating sarcopenia. This provides an effective approach for the treatment of sarcopenia.

The invention discloses a hypoglycemic active compound in ginger and a screening method and application thereof, and relates to the technical field of medicinal chemistry, and the screening method specifically comprises the following steps: S1, obtaining candidate compounds through a virtual screening method; s2, performing hypoglycemic activity evaluation on the candidate compound to obtain a target active compound. Compound screening is carried out based on a quantum chemistry and molecular docking method, the hypoglycemic activity is evaluated through the glucose uptake capacity of C2C12 cells, and the result shows that the hypoglycemic activities of the compounds 6-shogaol, 6-shogaol, 8-shogaol, 10-shogaol, zingerone phenol and zingerone are all higher than those of insulin, so that the hypoglycemic activity of the compounds 6-shogaol, 6-shogaol, 8-shogaol, 10-shogaol, 10-shogaol and zingerone is evaluated. The invention has a great application prospect in prevention or treatment of hypoglycemic diseases.

The invention discloses a natural compound for inhibiting disulfide death by taking VAV3 as a target spot and application of the natural compound. Belongs to the technical field of biological medicine and pharmacy. According to the invention, through virtual screening and surface plasmon resonance technologies, seven small molecular compounds, including kaempferol, liensinine, sophocarpidine, isorhamnetin, deoxyshikonin, harmine and potenoside, which can be specifically bound with VAV3 protein are screened from a natural product library for the first time. In a C2C12 cell insulin resistance model, the compounds can significantly reduce the cell death rate caused by disulfide death, and the action mechanism of the compounds is to improve the activity or expression of VAV3, inhibit abnormal accumulation of cystine and improve the NADPH level, thereby effectively preventing disulfide bond crosslinking and collapse of an actin filament network. Experiments show that the compound provided by the invention can effectively inhibit disulfide death of skeletal muscle cells by targeting VAV3, and a new lead compound and a solution are provided for developing drugs for treating diabetic muscle dysfunction and related metabolic diseases.

The invention discloses hemepeptide protein powder with a hypoglycemic function and application thereof.According to the hemepeptide protein powder with the hypoglycemic function, the activity and glucose uptake capacity of the hemepeptide protein powder (BPPP) on myotubular cells of a C2C12 mouse are evaluated through in-vitro experiments, and it is verified that under the condition that survival activity of the myotubular cells of the C2C12 mouse is not affected, the BPPP promotes the glucose uptake activity of the myotubular cells of the C2C12 mouse in a dose-dependent mode. A mouse in-vivo experiment shows that BPPP can reduce the fasting blood glucose value of an alloxan induced hyperglycemia mouse, the blood glucose reduction percentage is remarkably increased, and the area under a glucose tolerance curve is remarkably reduced, so that the blood peptide protein powder disclosed by the invention can recover the glucose regulation capability of a sick mouse. The invention provides a theoretical basis for application of the blood peptide protein powder in prevention and adjuvant therapy of diabetes and development of related functional foods.

This invention discloses the application of a traditional Chinese medicine composition in the preparation of a drug for treating sarcopenia, wherein the traditional Chinese medicine composition consists of Astragalus membranaceus and Anemarrhena asphodeloides. The study found that the combination of Astragalus membranaceus and Anemarrhena asphodeloides can significantly improve the differentiation function of C2C12 myoblasts induced by high glucose and inhibit lipid deposition, and improve skeletal muscle mass, muscle strength, and motor function in a streptozotocin-induced C57BL / 6 diabetic sarcopenia mouse model. In vitro and in vivo experiments have confirmed that this drug has significant effects in improving muscle atrophy, enhancing motor function, and restoring muscle strength; it can effectively increase the cross-sectional area of ​​muscle fibers, promote myotube fusion, and accelerate damage repair, showing a clear potential to inhibit diabetic muscle atrophy. This provides an effective traditional Chinese medicine compound intervention strategy for the clinical treatment of diabetic sarcopenia and has good prospects for development and application.

This invention relates to the field of tissue engineering technology and discloses a multi-level oriented muscle repair scaffold made from chitin nanocrystals and its preparation method. The invention uses chitin derived from shrimp and crab shells as raw material to prepare chitin nanocrystals. Through steps such as preparing an aqueous suspension of chitin nanocrystals, ultrasonic dispersion, directional freezing to induce ice crystal orientation growth, freeze-drying to control ice crystal sublimation, and glutaraldehyde cross-linking fixation, a multi-level oriented scaffold with a macroscopic oriented pore structure and a microscopic oriented micro / nanofiber structure is prepared, with the chitin nanocrystals arranged along the orientation pore direction. This scaffold has a high specific surface area, can promote the orientation alignment and myogenic differentiation of C2C12 cells, and can be effectively used for the repair of volumetric muscle tissue loss. Furthermore, the preparation method is simple, requires low-end equipment, is inexpensive, and can be mass-produced.

The invention relates to a preparation method of a muscle cell exosome for microRNA loading. The preparation method specifically comprises the following steps: step 1, culturing C2C12 cells in a C2C12 cell culture medium prepared from fetal calf serum, DMEM (dulbecco's modified eagle medium), double antibodies, glutathione and arginine; step 2, carrying out exosome extraction on the C2C12 cells, carrying out multiple times of differential centrifugation, and sequentially carrying out exosome washing and exosome purification; and step 3, carrying out microRNA (Ribonucleic Acid) loading on the obtained C2C12 cell exosome in a sterile state. Meanwhile, the invention also provides application of the exosome prepared by the preparation method in promoting proliferation and activity of muscle cells. According to the method, the secretion capacity of the exosome is improved by adopting the improved culture medium, and the loading efficiency and the stability of the microRNA are remarkably improved by combining an exosome transfer technology.