Patents
Literature
PatSnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

93 results about "Arsenite ion" patented technology

Fluorescent probes for saccharrides

InactiveUS20040087842A1Decrease of fluorescence emissionReduce sensitivityAnalysis using chemical indicatorsChemiluminescene/bioluminescenceFluoProbesTelluric acid
The spectroscopic and photophysical properties of fluorescent probes comprising donor-acceptor derivatives comprising the boric acid group or a derivative of boric acid, B(OH)3 (or borate ion, BO(OH)2<-1>), arsenious acid, H3 AsO3 (or arsenite ion, H2AsO3<-1>), telluric acid, H6TeO6 (or tellurate ion, H5 TeO6<-1>) or germanic acid, Ge(OH)6 (or germanate ion, GeO(OH)3<-1>) are described. Method of using said probes are also provided.
Owner:LAKOWICZ JOSEPH R +1

Cellulose base/Fe3O4 composite adsorption material used for removing arsenic in water and preparation method thereof

The invention relates to a cellulose base / Fe3O4 composite adsorption material used for removing arsenic in water and a preparation method thereof. According to the invention, with fibers or powder of natural cellulose or fibers of a cellulose derivative as a cellulose matrix material for the composite adsorption material, in an alkaline water system provided by ammoniacal liquor, Fe3O4 particles are loaded on the surface of the cellulose matrix material through in-situ co-precipitation, and the loaded Fe3O4 particles enable the obtained cellulose base / Fe3O4 composite adsorption material to have magnetism and to be easily removed from water, and allow harmful ions like arsenate ions and arsenite ions in water to be absorbed. Compared to arsenic removal materials in the prior art, the invention has the following characteristics: a natural biomass is used as an adsorption carrier, and the natural biomass is cheap and highly efficient, enables the content of arsenic in water to be substantially lower than a national standard and is easy to remove and convenient to use.
Owner:TECHNICAL INST OF PHYSICS & CHEMISTRY - CHINESE ACAD OF SCI

Preparation method and applications of lanthanum-loaded biochar arsenic-removing adsorbent

InactiveCN104815613AThe effect of adsorbing arsenic ions is obviousReduce pollutionOther chemical processesWater/sewage treatment by sorptionSorbentLanthanum
The present invention discloses a preparation method and applications of a lanthanum-loaded biochar arsenic-removing adsorbent. The preparation method mainly comprises: washing corn stalks, remove impurities, carrying out air-drying, crushing, screening, carrying out stirring mixing on the corn stalk powder and a lanthanum chloride solution under a certain condition, adjusting the pH value to the alkaline state, removing excess chlorine ions from the solution, and carrying out anoxybiotic calcination on the mixture for a certain time at a certain temperature so as to prepare the nanometer lanthanum oxide-loaded biochar material. According to the present invention, the prepared lanthanum-loaded biochar can be used for treating pentavalent arsenic ions in wastewater, and has characteristics of simple preparation, low cost, high adsorption efficiency, good application prospect, and the like.
Owner:JIANGSU ACADEMY OF AGRICULTURAL SCIENCES

Nanostructure material supporting arsenic ion adsorption compound and method to remove arsenic ion using the same

Means for reducing an arsenic ion concentration in the solution to the degree of ultra trace amount are provided. Ammonium molybdate is supported by a nanostructure material by mixing the nanostructure material, which is obtained after the nanostructure material such as an alumina reacts with a surfactant, in the solution containing the ammonium molybdate. The nanostructure material supporting an arsenic ion adsorption compound such as ammonium molybdate can selectively adsorb and remove trace of arsenic ion in the solution by a room temperature treatment without a water conditioning such as pH control. In our removal system of arsenic, extra posttreatments are not needed because special pretreatments are not carried out, and special heating equipments are not used. Accordingly, our removal system of arsenic can be constructed at low cost. Furthermore, it can supply an arsenic-free solution by be constructed at multi stages.
Owner:NAT INST FOR MATERIALS SCI

Preparation of cysteine surface modified CdTe or CdTe/CdS quantum dot and method for detecting arsenic by using quantum dot

The invention discloses a preparation method of a cysteine surface modified CdTe or CdTe / CdS quantum dot, which comprises the following steps of: under the condition of room temperature, mixing a cadmium-containing compound powder with cysteine, fully stirring and regulating the pH value to obtain a Cd precursor solution; then adding NaBH4 in Te powder, injecting an acid liquor, bringing H2Te gas generated by acidization under the action of a nitrogen flow out and introducing into the Cd precursor solution, heating for reaction and refluxing to obtain a CdTe quantum dot solution, adding Na2S solution in the CdTe quantum dot solution, and standing to obtain the cysteine surface modified CdTe / CdS nuclear shell quantum dot. The quantum dot disclosed by the invention is added in an arsenic ion-containing solution, and is subjected to fluorescent quantitative characterization by using a fluorospectro photometer to obtain a fluorescent response curve, and therefore, the qualitative or quantitative detection of the concentration of trivalent arsenic ions in a solution to be detected can be realized. The preparation method has the advantages of simpleness in operation, high sensitivity, good selectivity and the like.
Owner:HUNAN UNIV

Adsorbing material for removing arsenic from water and preparation method of material

The invention discloses an adsorbing material for removing arsenic from water and a preparation method of the material. The preparation method comprises the steps as follows: certain amounts of cerous salt and ferric salt are dissolved in appropriate water, hydrogen peroxide is taken as an oxidizing agent, and cerous ions are oxidized; and an alkali liquid is taken as a precipitator, a coprecipitation reaction happens, and drying is performed at a certain temperature, so that the amorphous ferric hydroxide adsorbing material loaded with nano cerium oxide is obtained. The arsenic-removing adsorbing material has a strong absorption action on arsenic ions in the water, and is simple in preparation process and low in cost; when arsenic in a water solution is processed, water is not required to be preprocessed; and the material can be applied to removing of arsenic in drinking water or industrial wastewater.
Owner:NANJING UNIV OF INFORMATION SCI & TECH

Fluorescent probes for saccharrides

The spectroscopic and photophysical properties of fluorescent probes comprising donor-acceptor derivatives comprising the boric acid group or a derivative of boric acid, B(OH)3 (or borate ion, BO(OH)2−1), arsenious acid, H3 AsO3 (or arsenite ion, H2AsO3−1), telluric acid, H6TeO6 (or tellurate ion, H5 TeO6−1) or germanic acid, Ge(OH)6 (or germanate ion, GeO(OH)3−1) are described. Method of using said probes are also provided.
Owner:LAKOWICZ JOSEPH R +1

Scorodite-type iron-arsenic compound particles, production method thereof, and arsenic-containing solid

Scorodite-type iron-arsenic compound particles in which the particle surface layer part comprise an iron-rich layer having an Fe / As molar ratio of at least 1.24. The particles can be obtained in a reaction process of feeding an oxygen-containing gas to an aqueous solution containing an arsenic(V) ion and an iron(II) ion to precipitate a scorodite-type iron-arsenic compound crystal at a pH of at most 2, in which an oxidizing agent is further added to the liquid before the end of the reaction (treatment A). The particles may also be obtained by a method comprising keeping a scorodite-type iron-arsenic compound particle of good crystallinity in contact with an iron ion-containing aqueous solution having a controlled pH of from 2 to 9 at 0 to 90° C. (treatment B). The scorodite-type iron-arsenic particles have good filterability and excellent arsenic release-preventing effect.
Owner:DOWA METALS & MINING CO LTD

Method for preparing arsenic adsorbent and method for treating waste water

The invention provides a method for preparing an arsenic adsorbent. The arsenic adsorbent has zirconium oxide of nano-pore structure. The material can effectively treat arsenate and arsenite in the waste water, and can be recycled after waste water treatment. Another objective of the invention is to provide a method for treating waste water containing arsenate or arsenite ions by the arsenic adsorbent prepared by the method. The method contains a 'regeneration' step, so that the arsenic adsorbent can be reused cyclically.
Owner:CHONGQING THREE GORGES UNIV

Arsenic removing water purification treatment method

The invention discloses an arsenic removing water purification treatment method and belongs to the technical field of water purification treatment. Arsenic in water exists in two main valence states including tervalence (arsenite ions) and pentavalence (arsenate ions), wherein the pentavalent arsenic can be removed by an iron salt flocculating agent, but the tervalent arsenic cannot be removed by the iron salt flocculating agent. According to the process, potassium hypermanganate is used for pre-oxidizing, and the iron salt flocculating agent and an auxiliary flocculating agent are added together; the arsenic in raw water is removed by a coagulant sedimentation method; finally, tiny floc, which is not settled and is adsorbed by the flocculating agents, is further intercepted by quartz sand filtering or an immersing type ultrafiltration membrane, so that the content of the arsenic in the output water reaches 0.1 microgram per liter.
Owner:毛允明

Novel arsenic aptamer nucleic acid sequence, and applications thereof in detection of arsenic ions

The invention discloses a novel arsenic aptamer nucleic acid sequence. The novel arsenic aptamer nucleic acid sequence is ACA GAA CAA CCA ACG TCG CTC CGG GTA CTT CTT C. The novel arsenic aptamer nucleic acid sequence is relatively short; synthesis is simple; cost is low; and auxiliary reagents such as nanogold and sodium chloride are easily available. In detection of arsenic ions, colorimetric method is adopted, a cheap spectrophotometer can be used for detection, equipment cost and reagent cost are both lower than that of conventional Ars-3 aptamer detection system, and the novel arsenic aptamer nucleic acid sequence is more suitable for rapid detection.
Owner:UNIV OF SHANGHAI FOR SCI & TECH

Sulfur-impregnated and coupling agent-reacted organoclay mercury and/or arsenic ion removal media

The use of two mercury and arsenic removal media: A) a sulfur-impregnated organoclay; and B) a coupling agent-reacted organoclay, wherein the coupling agent preferably contains a mercapto, disulfide, tretrasulfide and / or polysulfide end group provides mercury removal media having increased reactivity, stability, and synergistic mercury removal ability. The preferred mercury removal media described herein is prepared by reacting an organophilic clay containing onium ions A) with elemental sulfur; and B) with a sulfur-containing coupling agent, preferably containing a mercapto, disulfide, tetrasulfide, and / or polysulfide moiety.
Owner:AMCOL INTERNATIONAL CORPORATION

Iron-loaded cotton fiber material and preparation method thereof

The invention discloses an iron-loaded cotton fiber material with absorbent cotton fiber as basic skeleton and a preparation method thereof, belonging to the technical field of macromolecular material. The fiber material structurally contains the hydroxide of amorphous iron. The preparation method thereof comprises the steps of: taking the absorbent cotton fiber as the basic skeleton, loading ferric iron salt solution through dispersion and hydrolysis so that the structure of the fiber contains the hydroxide of amorphous iron. The reaction process is simple, the conditions are moderate, and the reaction agents adopted are nontoxic and environmentally-friendly. The fiber material keeps fibrous shape of the absorbent cotton fiber, has stable performance in air, and causes no pH change of water when being used as adsorbent in the water, and the iron-loaded shape of the adsorbent is stable so that arsenite ions in the water can be adsorbed effectually.
Owner:HENAN ACADEMY OF SCI CHEM RES INST CO LTD

Method for removing trivalent arsenic ion and pentavalent arsenic ion in water and system thereof

The invention relates to a method for removing trivalent arsenic ion and pentavalent arsenic ion in water and a system thereof. The invention comprises three parts which are arsenious water pretreatment, nanometer adsorption and desorption liquid treatment. The arsenious water is sent into a filter plant through a pipeline by a water pump. The filter plant is connected with a water inlet of a dearsenicator equipped with nanometer filter materials. The water outlet of the dearsenicator equipped with the nanometer filter materials is up to standard to discharge. The desorption liquid of the dearsenicator equipped with the nanometer filter materials is connected with a liquid inlet of a multi-level coagulation groove. The multi-level coagulation groove is connected with the liquid inlet of a sedimentation tank. The invention has simple technique, stable and reliable running, simple operation and easy control. No medicine is added in the processing process, which does not generate the secondary pollution after the water body is treated. The water obtained by using the method for removing trivalent arsenic ion and pentavalent arsenic ion in water is clear and reaches the discharge standard of national correlation water quality.
Owner:中矿威德能源科技(北京)有限公司

Adsorbent for efficiently removing arsenite ions from water, and preparation method thereof

The invention provides an adsorbent for efficiently removing arsenite ions from water, and a preparation method thereof, and relates to an adsorbent for efficiently adsorbing arsenite ions in water, and a preparation method thereof. In the prior art, the removal efficiency of the arsenite ions in the wastewater solution is not high. A purpose of the present invention is mainly to solve the problemin the prior art. According to the technical scheme, a metal complex CuxMn6-xLa2(OH)18.4H2O or CuxMn6-xFe2(OH)18.4H2O as an adsorbent is prepared by combining co-precipitation and hydrothermal treatment, and x is 2-5. With the technical scheme, the problem in the prior art is well solved. According to the present invention, the adsorbent prepared by the method can efficiently remove arsenite ionsfrom water, and can be used in the field of environmental protection.
Owner:CHINA PETROLEUM & CHEM CORP +1

Composite adsorption material for removing arsenic ions from natural water and preparation method for adsorption material

The invention discloses a composite adsorption material for removing arsenic ions from natural water and a preparation method for the adsorption material. Modified spent grains and a hydroxyl iron ion solution are used as raw materials. The method comprises the following steps of: adding spent grains subjected to high temperature treatment into a Ca(OH)2 solution for reacting, gelatinizing, aging, washing by using water and absolute ethanol, performing suction filtering, putting into a muffle furnace for firing, cooling, adding distilled water to prepare suspension, adding the hydroxyl iron ion solution, stirring, standing, washing a lower precipitate, drying, and grinding to obtain the adsorption material which has high adsorption property and can be strongly combined with the arsenic ions in the water. The preparation method is innovative, novel and unique, and the prepared material has a good adsorption effect on the arsenic ions in the water.
Owner:CHANGZHOU UNIV

Quantitative detection device and method for arsenic ions in water based on laser photo-thermal interference

The invention belongs to the field of optical biochemical detection. Traditional detection methods comprise an atomic absorption spectrometry method, an atomic fluorescence spectrometry method and other large instrument methods which are characterized by high accuracy and quantitative detection but have defects of complex operation, long detection period, high equipment cost and the like. the invention provides a quantitative detection device and method for arsenic ions in water based on laser photo-thermal interference. Two lasers pass through a dichroscope and are reflected by a plane mirrorto irradiate a detection area; arsenic ions in the solution are specifically combined with an aptamer chain wrapping the surface of nanogold; a high-concentration NaCl solution is added to cause aggregation of the gold nanoparticles; the solution is changed from wine red to bluish violet; laser beams irradiating a micro-channel interfere with each other and are received by a photoelectric detector, via an photothermal effect, the temperature of the solution is changed after the solution absorbs light to cause movement of interference fringes, the concentration of arsenic ions in water is quantitatively detected by measuring the photothermal signal difference of the two laser beams, and the device and method can be widely applied to the fields of environment, food detection, medical diagnosis and the like.
Owner:TAIYUAN UNIV OF TECH

Biomass waste activated carbon, preparation method thereof, and application of biomass waste activated carbon in treatment of nitrophenol compounds in wastewater

The invention discloses a preparation method of biomass waste activated carbon. The preparation method comprises the following steps: (a) grafting the surface of biomass wastes with 2-acrylamido-2-methyl-1-propanesulfonic acid; and (b) carbonizing the biomass wastes treated in step (a) to obtain the activated carbon. Compared with like products in the prior art, the biomass activated carbon prepared by the method has good adsorption capacity, reaching 480 mg / g or above, on p-nitrophenol, can almost completely remove lead ions, chromium ions, nickel ions and arsenic ions in water, has a good cycling stability, can still keep the adsorption capacity at 98% or above after being cycled for 5 times or above, and is a multifunctional comprehensive wastewater adsorbent.
Owner:GANSU AGRI UNIV

Ultrafine arsenic removal adsorbent and preparation method thereof, and arsenic removal method

The invention provides an ultrafine arsenic removal adsorbent and a preparation method thereof, and an arsenic removal method. The preparation method comprises: adding a surfactant into a solution containing Ca<2+>, Al<3+> and SO4<2->, then adjusting the pH to 10.6-12.9; and carrying out a heating stirring reaction, filtering, washing, and drying to obtain the ultrafine arsenic removal adsorbent.The ultrafine arsenic removal adsorbent prepared by the invention is monosulfur hydrated calcium sulphoaluminate (AFm), has a chemical formula of 3CaO.Al2O3.CaSO4.nH2O, belongs to a trigonal system, and is of a layered structure. Compared with the arsenic removal adsorbent in the prior art, the arsenic removal adsorbent of the invention has the following characteristics that the raw materials areeasy to obtain, the coat is low, arsenic ions in domestic water are adsorbed through solid, a solidified product formed after adsorption removal is still solid and is easy to separate, and the arsenicremoval adsorbent is environmentally friendly and free of secondary pollution. The prepared ultrafine arsenic removal adsorbent is solid, is convenient to transport, convenient to use and easy to popularize, and can be used in daily life of residents.
Owner:安徽海螺材料科技股份有限公司

Construction of sensitive arsenic ion whole cell biosensor and arsenic ion concentration detection method

The invention relates to construction of a sensitive arsenic ion whole cell biosensor and an arsenic ion concentration detection method. The sensor detection plasmid and the reporter plasmid are recombinant. The detection plasmid consists of an arsenic-specific protein regulatory promoter Pars, an arsenic-specific binding protein ArsR gene, and a self-feedback regulatory protein gene luxR. The reporter plasmid consists of a self-feedback promoter PluxRI, a red fluorescent protein mCherry gene and a self-feedback regulatory protein gene LuxR. By introducing a positive feedback amplification system based on the variant LuxR protein as a regulatory element, the sensitivity of the sensor is increased by 20 times to 0.1 micron, and the specific signal ratio is increased by 1.5 to 7.5 times. Thearsenic ion biosensor takes Escherichia coli DH5 as a host cell, has high sensitivity and specificity for arsenic ion detection, is not interfered by other metal ions, and has wide adaptability.
Owner:TIANJIN UNIV

Method and application of quickly screening arsenic ion aptamers

The invention relates to a reaction system of screening arsenic ion aptamers by means of a colorimetric method for optimizing an aptamer sequence of arsenic ions and detecting arsenic ions in water. The reaction system is characterized by comprising a nucleotide sequence, a nanogold solution and a sodium chloride solution, wherein the nucleotide sequence is TTA CAG AACAACCAACGTCGCTCCGGGTACTTCTTCATCG, TTA CAGAACAACCAACCCGGGTACTTCTTCATCG, TAG GGAGAT ACCAGC and TTACAGAACAACCGGTACTTCTTCATCG. The invention also provides an application of detecting arsenic ion concentration by means of the colorimetric method. As the screening process is simple and fast, an auxiliary reagent is relatively easily obtained, and measurement can be performed by means of naked eye judgment or a spectrophotometer, so that the screening difficulty of the aptamers is greatly reduced, and immobilized application and fast detection are facilitated.
Owner:UNIV OF SHANGHAI FOR SCI & TECH

Modified silk-screen printing electrode and application thereof

The invention discloses a modified silk-screen printing electrode and an application thereof. Printing raw materials of an electrode carbon layer comprise carbon paste, a carbon-based nano material and an oxalic acid, the mass fraction of the carbon-based nano material is 0.3-0.5%, the mass fraction of the oxalic acid is 1-1.6%, and the balance is the carbon paste; and gold nanoparticles are deposited on the surface of a working electrode of the electrode. When the modified screen-printed electrode is used for detecting a content of trivalent arsenic ions, an electrochemical signal can be effectively improved, and the enrichment capacity of the trivalent arsenic ions on the surface of the electrode can be increased; and during use, the detection cost is low, the sensitivity is high, dependence on large instruments and professional operators is avoided, and the application range is wide.
Owner:WUHAN ACADEMY OF AGRI SCI

Method for preparing arsenic adsorbent and method for treating waste water

The invention provides a method for preparing an arsenic adsorbent. The arsenic adsorbent has zirconium oxide of nano-pore structure. The material can effectively treat arsenate and arsenite in the waste water, and can be recycled after waste water treatment. Another objective of the invention is to provide a method for treating waste water containing arsenate or arsenite ions by the arsenic adsorbent prepared by the method. The method contains a 'regeneration' step, so that the arsenic adsorbent can be reused cyclically.
Owner:CHONGQING THREE GORGES UNIV

Method for treating heavy metal wastewater by superconductive HGMS-NZVI (high gradient magnetic separation-nanoscale zero valent iron) coupled technique

The invention relates to a method for treating heavy metal wastewater by a superconductive HGMS-NZVI (high gradient magnetic separation-nanoscale zero valent iron) coupled technique, belonging to the fields of resources and environments. The result proves that the optimal technological parameters of the superconductive HGMS-NZVI coupled technique are as follows: the addition amount of NZVI is 0.05-0.5 g / ml, the magnetic gradient is 3-5T, the standing time is 1-15 minutes, and the distance i between the reaction tank diameter d / magnetic field generator and the reaction tank wall is less than 3. The 4878.62ml of arsenic can be removed from every liter of high-concentration arsenic wastewater, and the removal ratio of arsenic ions in the wastewater is up to 99.56%. The operating method comprises the following steps: adding a right amount of NZVI into the heavy metal wastewater, uniformly stirring, injecting the wastewater in the reaction tank in a superconductive high-gradient magnetic field, and standing for some time. Before the treatment, no pretreatment is needed, and the pH value of the wastewater is not regulated. Under the technological conditions of the superconductive HGMS-NZVI coupled technique, the saturation adsorption quantity of NZVI is 16-18 mg / g (the arsenic ion adsorption quantity of 1g of NZVI), and the technological parameters can be properly regulated according to the arsenic ion concentration characteristic of wastewater.
Owner:UNIV OF SCI & TECH BEIJING +1

Arsenic adsorption material and preparation and recycling method thereof

The invention belongs to the technical field of adsorbing materials, solid waste resource utilization and wastewater treatment, and discloses an arsenic adsorbing material and a preparation and recycling method thereof. The preparation method of the arsenic adsorption material comprises the following steps: drying and crushing a biomass material, and dispersing the biomass material in a carbonate-containing alkaline solution according to a set concentration to obtain a suspension A; dropwise adding a metal cation mixed solution B with a set concentration into the suspension A at a set rate, and performing mineralization and centrifugal separation to obtain biomass-loaded layered double hydroxides; and carrying out high-temperature anaerobic cracking on the biomass-loaded layered double-metal hydroxide to obtain the arsenic adsorption material, namely the charcoal-loaded layered double-metal oxide. The maximum adsorbing capacity of the adsorbing material to arsenic ions reaches 49.9 mg / g, and after adsorbing arsenic, the adsorbing material can be desorbed and reconstructed in a set carbonate solution and is recycled through high-temperature anaerobic cracking again.
Owner:INST OF ROCK & SOIL MECHANICS CHINESE ACAD OF SCI +1

Sulfydryl-modified cyan fluorescent carbon quantum dot and application thereof in rapid detection of arsenic ions in water

The invention discloses a sulfydryl-modified cyan fluorescent carbon quantum dot and application thereof in rapid detection of arsenic ions, and the quantum dot is brown solid powder which is synthesized by taking tartaric acid and cysteine as raw materials through hydrothermal reaction and has the size of 4-10nm. The maximum excitation wavelength of the quantum dot is 320 nm, the maximum emission wavelength is 405 nm, and the quantum dot has good water solubility, light stability and biological compatibility. Under the condition of a PBS buffer solution system, the quantum dot can realize rapid detection of metal arsenic ions by utilizing fluorescence intensity change, and has the advantages of simplicity in operation, high sensitivity, good specificity, low detection limit, high stability, rapid response, good repeatability and the like, and the detection limit of the arsenic ions is 0.03 ppb. The preparation method of the quantum dot is simple, high in operation repeatability and low in cost, can be put into industrial production, and has a wide application prospect.
Owner:SHAANXI NORMAL UNIV

Method for treating heavy metal wastewater by superconductive HGMS (high gradient magnetic separation)-FeOOH coupled technique

The invention relates to a method for treating heavy metal wastewater by a superconductive HGMS (high gradient magnetic separation)-FeOOH coupled technique, belonging to the fields of resources and environments. The superconductive HGMS-FeOOH coupled technique for treating heavy metal wastewater has the advantages of simpler operation and higher treatment efficiency than the single absorption technique. The result proves that the superconductive HGMS-FeOOH coupled technique has favorable treatment effect under the conditions of the optimal technological parameters; and the removal rate of arsenic ions from high-concentration arsenic wastewater can reach higher than 77.12% under the following conditions: the addition amount of FeOOH is 0.1-0.9 g / ml, the magnetic gradient is 3-5T, the standing time is 1-15 minutes, and the distance i between the reaction tank diameter d / magnetic field generator and the reaction tank wall is not greater than 3. Before the treatment, no pretreatment is needed, and the pH value of the wastewater is not regulated. Under the technological conditions of the superconductive HGMS-FeOOH coupled technique, the saturation adsorption quantity of FeOOH is 6.5-7.5 mg / g, and the technological parameters can be properly regulated according to the arsenic ion concentration characteristic of wastewater.
Owner:UNIV OF SCI & TECH BEIJING +1

Treatment method of arsenic-containing organic wastewater

The invention relates to a treatment method of arsenic-containing organic wastewater, which comprises the following steps: (1) regulating the pH value of the arsenic-containing organic wastewater to 2-4, and enabling the pH-regulated wastewater to flow through a nano-iron particle generation device, so that the nano-iron particle generation device generates nano-iron particles in situ in the wastewater; (2) adding H2O2 into the wastewater added with the nano-iron particles to carry out nano-iron / heterogeneous Fenton oxidation reaction until the reaction is finished; and (3) adjusting the pH value of the reacted mixed solution to 8-9, and separating out the arsenic ion flocculent precipitate from the wastewater. The treatment method provided by the invention has good arsenic removal and CODremoval effects on arsenic-containing organic wastewater, and can meet increasingly strict arsenic discharge standards.
Owner:LASER RES INST OF SHANDONG ACAD OF SCI

Method for removing arsenic ions in water through N element modified graphene electrode

The invention relates to a method for removing arsenic ions in water by modifying graphene electrodes with N elements, comprising the following steps: preparing nitrogen-doped graphene airgel, preparing nitrogen-doped graphene airgel paper electrodes, and adjusting the voltage on the electrodes to water Adsorption and desorption of heavy metal ions. The beneficial effects of the present invention are: the preparation method of nitrogen-doped graphene airgel is simple and easy, and the preparation process is environmentally friendly and pollution-free; the electrode modified with this material has high adsorption efficiency, fast speed, and simple operation for heavy metal ions in water; Compared with conventional materials, the recycling performance has been greatly improved.
Owner:CHANGZHOU UNIV